ID: 990569062 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:57059638-57059660 |
| Sequence | AGGTTTTAGCTGAGGGAGTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 990569062_990569067 | 8 | Left | 990569062 | 5:57059638-57059660 | CCTTACTCCCTCAGCTAAAACCT | No data | ||
| Right | 990569067 | 5:57059669-57059691 | ATGCTGAATAATAATTGTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 990569062 | Original CRISPR | AGGTTTTAGCTGAGGGAGTA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||