ID: 990569062

View in Genome Browser
Species Human (GRCh38)
Location 5:57059638-57059660
Sequence AGGTTTTAGCTGAGGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990569062_990569067 8 Left 990569062 5:57059638-57059660 CCTTACTCCCTCAGCTAAAACCT No data
Right 990569067 5:57059669-57059691 ATGCTGAATAATAATTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990569062 Original CRISPR AGGTTTTAGCTGAGGGAGTA AGG (reversed) Intergenic
No off target data available for this crispr