ID: 990575404

View in Genome Browser
Species Human (GRCh38)
Location 5:57119083-57119105
Sequence TGAACCTGTCCTGGTTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990575404_990575407 -6 Left 990575404 5:57119083-57119105 CCCTCAGAACCAGGACAGGTTCA No data
Right 990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990575404 Original CRISPR TGAACCTGTCCTGGTTCTGA GGG (reversed) Intergenic