ID: 990575405

View in Genome Browser
Species Human (GRCh38)
Location 5:57119084-57119106
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990575405_990575407 -7 Left 990575405 5:57119084-57119106 CCTCAGAACCAGGACAGGTTCAG No data
Right 990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990575405 Original CRISPR CTGAACCTGTCCTGGTTCTG AGG (reversed) Intergenic