ID: 990578191

View in Genome Browser
Species Human (GRCh38)
Location 5:57143883-57143905
Sequence TGTTCAATGCTGAAACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990578186_990578191 13 Left 990578186 5:57143847-57143869 CCAATGTTTCTTTGTTGGCTTTC No data
Right 990578191 5:57143883-57143905 TGTTCAATGCTGAAACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990578191 Original CRISPR TGTTCAATGCTGAAACTGGA GGG Intergenic
No off target data available for this crispr