ID: 990583762

View in Genome Browser
Species Human (GRCh38)
Location 5:57190207-57190229
Sequence TAGAGCTATTTTTAACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990583757_990583762 27 Left 990583757 5:57190157-57190179 CCTTACTTTTTTTTAGGGGGGGG 0: 1
1: 3
2: 11
3: 67
4: 332
Right 990583762 5:57190207-57190229 TAGAGCTATTTTTAACTGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990583762 Original CRISPR TAGAGCTATTTTTAACTGCT TGG Intronic
901787059 1:11631761-11631783 TTGGGGCATTTTTAACTGCTTGG - Intergenic
903700351 1:25242799-25242821 TAGAGATATTATCAATTGCTGGG + Intronic
904279722 1:29410354-29410376 CAGAGCCATTTTCACCTGCTGGG - Intergenic
906378702 1:45317656-45317678 TGGAGCTTTTTTTAAATGTTGGG - Intergenic
908614371 1:65901895-65901917 TTGAGATCTTTTTAACTTCTTGG + Intronic
909244563 1:73262830-73262852 CAGAGCCATTTTTATGTGCTGGG - Intergenic
909277810 1:73710254-73710276 TAAATCTATTTTTATCTTCTTGG + Intergenic
909327547 1:74370266-74370288 TAAATCTATTTTTAAATTCTAGG + Exonic
910096113 1:83524031-83524053 TGGATCTATGTTTAACTGCAAGG + Intergenic
911718917 1:101168509-101168531 TAGTGCTCTTTTTCTCTGCTAGG + Intergenic
912180683 1:107215843-107215865 TAGAGGTCTTTTTACCTCCTTGG + Intronic
916103228 1:161410783-161410805 TATAACTTTTTTTAACTCCTAGG + Intergenic
916265881 1:162889403-162889425 TAGATCTAATTTTACCTTCTTGG - Intergenic
917047673 1:170880266-170880288 TAGAGCTATAATAAATTGCTAGG - Intergenic
918026386 1:180752965-180752987 AAGAGCAACTTTTAACTACTTGG - Intronic
918720199 1:187842656-187842678 CACAGCTATTTCTAACTGCAAGG + Intergenic
918858969 1:189796862-189796884 TTGAGATTTTTTTAACTTCTTGG - Intergenic
919674573 1:200368460-200368482 TAGAAATAATTTTAAGTGCTTGG + Intergenic
920830102 1:209456806-209456828 TACACTTATTTTTAACTGTTGGG + Intergenic
922407309 1:225328564-225328586 AAGACCTATTTTTAACTGGAAGG - Intronic
923007271 1:230060540-230060562 TAGACATATTATTCACTGCTGGG - Intronic
924506380 1:244689434-244689456 AAGAGACATTTTTAACTTCTTGG - Intronic
1063262039 10:4400543-4400565 TGGTGCTATTTTTAACACCTGGG - Intergenic
1063732606 10:8716047-8716069 TAGTTCTTTTTTTAAATGCTTGG + Intergenic
1064095275 10:12419677-12419699 TAGAGTTCTTGTTAACTTCTAGG + Intronic
1064514821 10:16135535-16135557 TAGAATTATTGTTAACAGCTGGG - Intergenic
1070147232 10:73783681-73783703 TAAAACTTTTTTTAACTGCGTGG - Intergenic
1071838201 10:89440952-89440974 TCCAGCTCTGTTTAACTGCTAGG + Intronic
1074876546 10:117618009-117618031 AAAAGCTTTTTTTAACTACTGGG - Intergenic
1081088212 11:38827037-38827059 TTGAGATATTTTTAACTTCTTGG - Intergenic
1085002813 11:73056348-73056370 AGGAGTTATTTTTTACTGCTAGG + Intronic
1086186085 11:84018176-84018198 TACAGATATATTAAACTGCTAGG + Intronic
1087660249 11:100979287-100979309 TATAGCAATTTTTATCTTCTAGG - Intronic
1088177579 11:107071723-107071745 TAAAACTATTTTTTACTTCTTGG - Intergenic
1088471388 11:110190953-110190975 TAGAGCTTTTCTTGGCTGCTGGG - Intronic
1092251758 12:6902817-6902839 TAGAGCTTTTACTAAGTGCTAGG - Intronic
1093371308 12:18368580-18368602 GACAGATATTTTTAACTGATAGG - Intronic
1093866194 12:24229884-24229906 TAGAACTCTTTATAACTGCCTGG - Intergenic
1095788438 12:46136984-46137006 AACAGTTTTTTTTAACTGCTTGG - Intergenic
1095806867 12:46329379-46329401 TAATGCTATTTTTCATTGCTTGG - Intergenic
1097296797 12:57974116-57974138 TAAAACTATTTTTAACTCTTTGG - Intergenic
1097592004 12:61586393-61586415 TAGAGTTAGTTTTAAGTGATTGG + Intergenic
1098836568 12:75430251-75430273 TAGAGCTAACTTTACCTTCTGGG + Intronic
1100868573 12:98885840-98885862 TTGAGCTATGTTTTATTGCTTGG - Intronic
1102809820 12:115814626-115814648 AAGGGCTATTTTTAAATGCATGG + Intergenic
1106820698 13:33461565-33461587 TTGAGGTATTTTTGCCTGCTAGG + Intergenic
1107703657 13:43076527-43076549 TAAAGTTATTTTTAGCTGGTGGG - Intronic
1107905777 13:45059946-45059968 TACAGCTATTGTTATGTGCTAGG + Intergenic
1109117721 13:58409865-58409887 TAGGGCTATTTTTTACTTCTTGG - Intergenic
1109563741 13:64083164-64083186 TAGAGATATTTTTACCTCCTTGG + Intergenic
1109913249 13:68944549-68944571 TAGTGTTATTTTTATCTGTTTGG - Intergenic
1110526401 13:76543323-76543345 TAGAGCTATTTTTCACAGGTAGG - Intergenic
1111115500 13:83771816-83771838 TAGAGCTTATTTTACTTGCTTGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112424278 13:99282576-99282598 TAAAGATATTTATAACTGTTGGG + Intronic
1115485421 14:33906535-33906557 TAGAGCTTTTTATATCTTCTTGG - Intergenic
1116566753 14:46455503-46455525 TAGTTCTATTTTTAACTTTTAGG + Intergenic
1117639287 14:57780374-57780396 TAGAGATATTTTTCTCTCCTTGG - Intronic
1120540722 14:85747450-85747472 TAGTTCTATTTTTAATTGTTGGG + Intergenic
1121160398 14:91733848-91733870 TATATCTAATTTTCACTGCTGGG - Intronic
1127037544 15:54934848-54934870 TATAACAATTTTTACCTGCTAGG + Intergenic
1127255194 15:57284644-57284666 TAGTGCTCTTTTTCACAGCTTGG - Intronic
1127357267 15:58212295-58212317 AAGAGCTATTTTGAAATTCTTGG + Intronic
1127447436 15:59079028-59079050 AAGAACTTTTTTTAACTGTTGGG + Intronic
1127494049 15:59493002-59493024 TAGGGCTATTTTTATCTGGCTGG + Intronic
1130170756 15:81510541-81510563 TAGAACTAATTTTTGCTGCTGGG + Intergenic
1132058062 15:98667571-98667593 TGGGGCTATTTTTTTCTGCTTGG + Intronic
1133071686 16:3250653-3250675 TAGAGCTATTCATAACTGTTAGG - Intronic
1133482654 16:6186181-6186203 AAGTGCTTTTTTTAACTCCTGGG + Intronic
1137766380 16:50980861-50980883 CAGGGCTATTTATAACTCCTAGG + Intergenic
1139025574 16:62813663-62813685 TATAGCTACTTTTAAATTCTTGG - Intergenic
1139791714 16:69442907-69442929 CAGAGCTAATTTTTACTACTTGG + Intronic
1146188206 17:30740199-30740221 TAGAGATAATTTTAAAAGCTTGG + Intergenic
1146333075 17:31944519-31944541 TAGAGATAATTTTAAAAGCTTGG + Intronic
1146364373 17:32208577-32208599 TAAAACTATTTTTTAATGCTGGG - Intronic
1147638486 17:41978918-41978940 TATAGATCTTCTTAACTGCTAGG + Intronic
1150901615 17:69283938-69283960 TAGTTCTGTTTTTACCTGCTTGG + Exonic
1151180744 17:72325748-72325770 CAGAGCTATGTCTAAATGCTGGG + Intergenic
1151286593 17:73116445-73116467 AAGAGATATTTTTAACTCTTCGG - Intergenic
1155003564 18:21708203-21708225 CAGAGCTGTTTTTTACTCCTAGG - Intronic
1155327407 18:24678745-24678767 TTGAGGTCTTTCTAACTGCTTGG + Intergenic
1155891335 18:31273746-31273768 TAGAGCAATTTTGAATTTCTTGG - Intergenic
1156149821 18:34227809-34227831 TAGAGCTTTATGTAAGTGCTGGG + Intergenic
1156160499 18:34352258-34352280 TGGAGATTTTTTTAATTGCTTGG - Intergenic
1157462080 18:47907144-47907166 TAGATCTATGTTTAACTTTTTGG - Intronic
1158080604 18:53585634-53585656 TAGAGCTATTTTGACCCTCTTGG + Intergenic
1160057551 18:75498086-75498108 TAGAGCTTTTTTATATTGCTCGG + Intergenic
1161555436 19:4939547-4939569 TAGAGCCATTTGGAACTCCTGGG - Intronic
1165799447 19:38538643-38538665 TAGATTTATTTTTAAATGCCAGG - Intronic
1167757752 19:51423248-51423270 CAGGGCTATTTTTATCTTCTTGG - Intergenic
928161180 2:28926503-28926525 AAGAGATATTTCAAACTGCTGGG + Exonic
929394610 2:41508468-41508490 TTGAGATAATTTTAACTTCTGGG - Intergenic
930609465 2:53524971-53524993 TGGAGCTATTTTCAGCTTCTAGG + Intergenic
931322875 2:61189007-61189029 TAGAGCTGGGTTTAACTGTTTGG + Exonic
931505704 2:62923580-62923602 TAGAGCTACTTCTCACTCCTGGG - Intronic
933062276 2:77753059-77753081 TAAAGCTATTTTTAAATTATAGG - Intergenic
937555610 2:123151587-123151609 TTTAGAAATTTTTAACTGCTTGG - Intergenic
938558397 2:132447485-132447507 TAGAGATATCTTCAGCTGCTAGG + Intronic
941577551 2:167252306-167252328 TTGACATATTTTTAACTGCCAGG + Intronic
942940900 2:181615452-181615474 TAGAGCTGGATTTATCTGCTTGG + Intronic
943250294 2:185513045-185513067 TTGAGCCATTTTGAAGTGCTGGG + Intergenic
943541664 2:189222849-189222871 GAGATCTATTTTTCATTGCTTGG - Intergenic
943804103 2:192100647-192100669 TAGAGCTGTTTAAAACTCCTTGG + Intronic
1170617504 20:17966141-17966163 TAGTGCTATTTTTAACTAGGGGG - Intronic
1170874960 20:20242039-20242061 TTGAGCTATTTTTAAATGTCAGG + Intronic
1172046770 20:32085992-32086014 TAAAGCTATTTTTATTTGTTTGG + Intronic
1176342545 21:5712175-5712197 TATAGCTATTTGCAACTGGTGGG - Intergenic
1176474799 21:7144326-7144348 TATAGCTATTTGCAACTGGTGGG - Intergenic
1176502282 21:7612281-7612303 TATAGCTATTTGCAACTGGTGGG + Intergenic
1176536866 21:8110244-8110266 TATAGCTATTTGCAACTGGTGGG - Intergenic
1178795370 21:35739061-35739083 AAAAGCTATTTTTAACAGGTTGG + Intronic
1179206349 21:39283698-39283720 AACAGGTATTTTTAACTTCTGGG + Intronic
1179590104 21:42402303-42402325 TAGAGCTTTGTACAACTGCTTGG + Intergenic
1180063602 21:45401636-45401658 TAGAGCTATTTTCAAATTCATGG + Intergenic
1182767060 22:32765199-32765221 CAGAGCTAATTTTAACTTCTTGG - Intronic
1182833807 22:33325301-33325323 CAGAGTTATTCTTAACTGCAAGG - Intronic
1182895564 22:33856420-33856442 TAGATCTATTTATCACTTCTAGG - Intronic
1203241814 22_KI270733v1_random:26650-26672 TATAGCTATTTGCAACTGGTGGG - Intergenic
949663252 3:6306550-6306572 TGGAGCTTTTTATAACTGATAGG - Intergenic
951242482 3:20303378-20303400 TAGAACTATTTCTAACTTCCTGG - Intergenic
954285078 3:49613231-49613253 TAGAGCTATTTTTTTCTCTTTGG - Intronic
955644055 3:61117760-61117782 TAGAGCCTTTTTAAAGTGCTAGG - Intronic
955957694 3:64307284-64307306 TAGAAGTATTATTAACTGGTGGG - Intronic
956094844 3:65704971-65704993 CAGAGCCATTTTTAATTGGTTGG - Intronic
956332742 3:68129329-68129351 TACAGCTCTTTTTAAATGCTGGG - Intronic
956343304 3:68249959-68249981 TAGAGCCATTTTTCATTGTTTGG - Intronic
962253062 3:133850401-133850423 ATGAACTATTTTTAAATGCTTGG - Intronic
966169670 3:177064764-177064786 TAAAGCTATGTTTTACTGCATGG - Intronic
966438940 3:179922091-179922113 TAGACCGACTTGTAACTGCTGGG + Intronic
968123508 3:196142441-196142463 TAGAACAATTTTTAACTTGTAGG + Intergenic
971242536 4:24901542-24901564 AACTGCTATTTTTAACTGATGGG - Intronic
975107413 4:70583133-70583155 TAGAGAAATTTTAAACTGTTTGG + Intergenic
976881441 4:89930643-89930665 TAGAGTCATTTTTAACTAATGGG + Intronic
977535906 4:98256761-98256783 TACAGCTATCTTTAACTAGTAGG + Intergenic
978928668 4:114283653-114283675 AAGAGGTATTTTTAACATCTAGG - Intergenic
980692883 4:136319268-136319290 TAAAGCTATTTTTAAAAACTTGG - Intergenic
982993349 4:162307973-162307995 TAAAACTATTTTTAACTACAAGG + Intergenic
983149568 4:164261515-164261537 TAGAGCTATGCTTAAGTGTTAGG - Intronic
985346024 4:189005348-189005370 TAGAGCTGTATTTAACCCCTGGG + Intergenic
987468238 5:18297702-18297724 TTGATCTATTGTTAACTTCTAGG - Intergenic
990583762 5:57190207-57190229 TAGAGCTATTTTTAACTGCTTGG + Intronic
991601091 5:68351814-68351836 TATAGCTATTTTTCAGTGATTGG + Intergenic
992126957 5:73652123-73652145 TGTAACTATTTTTAAGTGCTAGG + Intronic
992190810 5:74289901-74289923 TTGAGCTATTTTTAAAATCTTGG + Intergenic
993563137 5:89437348-89437370 TAGAACTTTTCTTAACTGCTTGG + Intergenic
993957238 5:94249249-94249271 TATAGCCATTTTTGTCTGCTAGG - Intronic
996053545 5:118959389-118959411 TAGAGATTTTTTTACCTCCTTGG - Intronic
999140204 5:149356161-149356183 TAGAGCTGTTTTTTTCTGTTAGG - Intergenic
1001413848 5:171529294-171529316 TTGAGATGTTTTTAACTTCTCGG - Intergenic
1001895200 5:175372966-175372988 TTGAGCTTTTTTTATATGCTTGG + Intergenic
1004615949 6:17289104-17289126 TTGTGCTTTTTGTAACTGCTAGG + Intronic
1004622724 6:17345188-17345210 TACATCTATTTTTAACATCTTGG + Intergenic
1004967854 6:20874957-20874979 TTGAGATATTTTGAACTGATGGG + Intronic
1006431190 6:33997481-33997503 TAGAACTCTTTTACACTGCTAGG + Intergenic
1010438875 6:75869782-75869804 TTCAGTTATTTTTAAATGCTTGG - Intronic
1011158047 6:84355708-84355730 AGGAGCTAATTTTATCTGCTTGG + Intergenic
1014426645 6:121314758-121314780 CTGGGCCATTTTTAACTGCTTGG - Intronic
1014611146 6:123548419-123548441 TAGAGATATATCTAACTGCTAGG - Intronic
1015857611 6:137641864-137641886 TATAGATATTTTCAAGTGCTTGG - Intergenic
1016613016 6:146014642-146014664 TAGTGCTTTTTTTAAGTTCTAGG - Intergenic
1016721235 6:147301244-147301266 TAGTTCTATTTTTAACTTTTTGG - Intronic
1018069458 6:160149655-160149677 TTGAGATATTTTTAAATGATTGG - Intronic
1018415317 6:163596505-163596527 TAAACCTATTTTGAACTGATCGG + Intergenic
1018624274 6:165762655-165762677 TAGAGCTATATTTATTTGATTGG - Intronic
1022354804 7:29603628-29603650 TATAGCTATTATTAATTGATTGG - Intergenic
1023307165 7:38842557-38842579 TAAAGCCATTTTTCACTGCGTGG + Intronic
1024668652 7:51570179-51570201 TAGATCTATTTTTCACTTGTAGG - Intergenic
1024808313 7:53176172-53176194 TAGATCTATTTTTAATTTTTAGG - Intergenic
1026227882 7:68458710-68458732 TTCAGCTATATTCAACTGCTGGG + Intergenic
1027646392 7:80805795-80805817 TAAAGCTATTTTGAAATTCTAGG + Intronic
1028304195 7:89241655-89241677 ATGAGCTATTTTTTACTGCATGG + Intronic
1028742248 7:94288928-94288950 AAGAGCAATTCTTAACTGTTAGG + Intergenic
1031216918 7:118905957-118905979 TAGAGCTCTTTTGCCCTGCTGGG + Intergenic
1031632323 7:124059157-124059179 TAGTGATATTTCTAACTGCAGGG + Intergenic
1033883055 7:145911473-145911495 TAGAGTCATTGTTATCTGCTTGG + Intergenic
1036485504 8:9175358-9175380 TAGAGATGTTTTCAACTGCATGG + Intergenic
1038084166 8:24175095-24175117 TTGAGGTATTTTTAAATCCTAGG - Intergenic
1039749992 8:40469956-40469978 TAGTGATATTTATCACTGCTGGG + Intergenic
1042359115 8:67862329-67862351 AACAGCTATTTTTTATTGCTGGG + Intergenic
1043316768 8:78932461-78932483 TAGAGCTATCTTTAGCTGCAGGG + Intergenic
1043834335 8:85029967-85029989 AAGAGATAATTTCAACTGCTAGG - Intergenic
1045337483 8:101221587-101221609 GAGAGCTATCTTTAGCAGCTTGG + Intergenic
1047260911 8:123258910-123258932 TAGAGCTATTTTTAATTTACTGG + Intronic
1047698343 8:127426210-127426232 TAGAGCTATTTATGACTCCCAGG - Intergenic
1047888972 8:129286143-129286165 TAGGGCTATTTTTTAATACTTGG + Intergenic
1048416522 8:134232956-134232978 AAGTGCTCTTTGTAACTGCTGGG - Intergenic
1048496345 8:134939222-134939244 TTGAGCTATTTATAACTGACTGG - Intergenic
1049347156 8:142145160-142145182 TGGAGCAGTTTTTGACTGCTGGG + Intergenic
1052548595 9:29915548-29915570 TAGAATTATTATTAACTACTTGG - Intergenic
1053246649 9:36539995-36540017 TACATCTCATTTTAACTGCTGGG - Intergenic
1053923185 9:43020415-43020437 TAGAGTAATTTTTTTCTGCTAGG - Intergenic
1058240404 9:102550671-102550693 TAGAGCTTTTTTTAATTTCATGG + Intergenic
1058242966 9:102589641-102589663 TAGAGCTATGTTTAAATTTTGGG - Intergenic
1059612609 9:115915557-115915579 TAAAGTTATTTTTTTCTGCTGGG + Intergenic
1203458135 Un_GL000220v1:9726-9748 TATAGCTATTTGCAACTGGTGGG - Intergenic
1189615472 X:42778728-42778750 TAGAGCTAATTATATCAGCTGGG + Intergenic
1191712819 X:64170161-64170183 CAGAGATATTCTTAAATGCTTGG - Intergenic
1193987492 X:88262637-88262659 TAGCGCTTTCTTTAACTGTTTGG + Intergenic
1194325230 X:92507325-92507347 TTGAGCTGTTTCTAACTTCTTGG + Intronic
1194553170 X:95326002-95326024 TAGAGATTTTTTTACCTCCTTGG - Intergenic
1198581548 X:138070905-138070927 CAGAGATTTCTTTAACTGCTTGG + Intergenic
1199201204 X:145091296-145091318 GTGAGCTTTTTCTAACTGCTGGG - Intergenic
1200633960 Y:5626506-5626528 TTGAGCTGTTTCTAACTTCTTGG + Intronic
1202133244 Y:21633895-21633917 TAGAGTTATTATTAATTGTTAGG + Intergenic