ID: 990587162

View in Genome Browser
Species Human (GRCh38)
Location 5:57223620-57223642
Sequence GTGTGAGGAGGTAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1179
Summary {0: 1, 1: 1, 2: 9, 3: 100, 4: 1068}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990587162_990587168 -5 Left 990587162 5:57223620-57223642 CCACCTTCCTTACCTCCTCACAC 0: 1
1: 1
2: 9
3: 100
4: 1068
Right 990587168 5:57223638-57223660 CACACCTCCGTAAGGCTGTTTGG 0: 1
1: 0
2: 3
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990587162 Original CRISPR GTGTGAGGAGGTAAGGAAGG TGG (reversed) Intronic
900345804 1:2209779-2209801 GTGTGAGCAGGGCAGGAGGGAGG - Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900681757 1:3920375-3920397 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
900681806 1:3920541-3920563 GAGGGAGGGGGGAAGGAAGGAGG - Intergenic
900775839 1:4584995-4585017 GTGTTTGGAGGTGGGGAAGGTGG - Intergenic
900852706 1:5156679-5156701 GAGTGAGGAGAGAAGGAGGGAGG + Intergenic
900926750 1:5710761-5710783 GAGGGAAGAGGGAAGGAAGGAGG + Intergenic
900975148 1:6012048-6012070 GTGGGTGGAGGTGATGAAGGTGG + Intronic
901219709 1:7576506-7576528 GTGTGAGGACGCAAGCAAGAAGG + Intronic
901236935 1:7672204-7672226 GGGTGAGGAGGAAAGGTACGGGG + Intronic
901914441 1:12487218-12487240 GGGTGAGGAGGAAAAGAAAGGGG - Intronic
902092649 1:13915785-13915807 GTGTTCAGAGATAAGGAAGGTGG - Intergenic
902985746 1:20153097-20153119 GTGTGAGGGGGAAAGGGAGCGGG + Intergenic
903050417 1:20596251-20596273 GTGGGAGGAGGTTAGGAACATGG + Intronic
903195828 1:21687458-21687480 GTGTGAAGAGGAAAGGCAGGGGG + Intronic
903350517 1:22713732-22713754 GGCTGAGGAGACAAGGAAGGAGG - Intronic
903598572 1:24516331-24516353 GTGCGTTGAGGTAAGAAAGGAGG + Intronic
903946566 1:26967772-26967794 GGGTGTGGAGGTGAGGAAGGGGG - Intergenic
904170049 1:28585365-28585387 GCGTGATGAGGGCAGGAAGGAGG - Intergenic
904322611 1:29707311-29707333 GAGTGGGGAGGGAAGGAGGGAGG + Intergenic
904448360 1:30594284-30594306 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
904497602 1:30895858-30895880 GTGGGAGGAGGGAGGGAGGGAGG + Intronic
904697170 1:32337030-32337052 GTGTGTGGAGGTAAAGAGGAAGG - Intergenic
905587552 1:39132757-39132779 GTGGGGGGTGGGAAGGAAGGAGG + Intronic
906059172 1:42937117-42937139 GTGGGAGCAGGGAAGGAAGAGGG - Intronic
906153427 1:43600800-43600822 GGGGGAGGAGGGAAGGAAGGAGG - Intronic
906281500 1:44557401-44557423 GAGAGAGGAAGGAAGGAAGGAGG + Intronic
906405265 1:45537041-45537063 GTGTGTCAAGCTAAGGAAGGAGG - Intergenic
906707749 1:47907058-47907080 GCGTGGGGAGGGAAGGAAGTGGG + Intronic
906870866 1:49479436-49479458 GTGGGAGGAAGTAGGGAAGCAGG - Intronic
907110167 1:51919897-51919919 ATGAGGGGAGGTCAGGAAGGTGG + Exonic
907264692 1:53250463-53250485 GTTTGAGGAAGGAAAGAAGGAGG + Intronic
907317340 1:53580752-53580774 GTGTGAGGAAGGAAGGAAAGCGG - Intronic
907342620 1:53747782-53747804 GGATGAGGAGGGAAGAAAGGAGG - Intergenic
907440793 1:54476828-54476850 GCATGAGTAGGGAAGGAAGGGGG - Intergenic
907573534 1:55505697-55505719 GTGGGAGGAGGTATGGAGTGGGG + Intergenic
907922266 1:58924727-58924749 GTGTGAGGTGGGAAGAAAAGAGG - Intergenic
907974517 1:59418469-59418491 GAGTGAGCAGGAAGGGAAGGAGG + Intronic
907990423 1:59577117-59577139 CTGGGAGGAGGTAAGGATGGCGG - Intronic
908742450 1:67342627-67342649 GTGTGAGGATGTGAGGATGTTGG + Intronic
909016829 1:70389031-70389053 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
909483081 1:76146505-76146527 GTGTGAGGGAGAAAAGAAGGAGG - Intronic
909725834 1:78833811-78833833 CTTTGAGGAGGGAAAGAAGGCGG - Intergenic
909959566 1:81823355-81823377 GAGGGGGGAGGGAAGGAAGGAGG - Intronic
910121932 1:83799628-83799650 GTGTGATGGGAGAAGGAAGGGGG + Intergenic
910127179 1:83855550-83855572 GTGTGAGGAGTCAGGGAGGGTGG - Intergenic
910798684 1:91123628-91123650 GTGAGAGGAAGGAAGGGAGGAGG + Intergenic
910981819 1:92965676-92965698 GAGTGAGTAGGTGAGGAATGAGG + Intergenic
911050407 1:93666051-93666073 GGATGAGGAGGGAAGGCAGGAGG - Intronic
911083619 1:93957838-93957860 GTCAGAGGAGGTGAGGAAGAAGG - Intergenic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
912141270 1:106731117-106731139 GGGGGAGGAGGGGAGGAAGGAGG + Intergenic
912308474 1:108595419-108595441 GAGAGAGGAGGAAAGGAGGGAGG + Intronic
912345596 1:108960745-108960767 CTGTGAGGAGGTTAGGATGGGGG + Intronic
912368095 1:109151320-109151342 GTGGGAGGAGGGAGGGAGGGAGG + Intronic
912777887 1:112517463-112517485 GTCTCAGGAGTTAGGGAAGGGGG + Intronic
912852766 1:113141217-113141239 GTGTGAGGAGGTGGGGAAGAGGG - Intergenic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913583961 1:120254796-120254818 GGGAGGGGAGGGAAGGAAGGAGG + Intergenic
913624220 1:120643544-120643566 GGGAGGGGAGGGAAGGAAGGAGG - Intergenic
914247595 1:145897469-145897491 GTGGGAGAAGGAAAGAAAGGAGG - Intronic
914255673 1:145960241-145960263 GTGAGAGGAGCCAAGGAGGGTGG - Exonic
914396122 1:147270309-147270331 GCGAGAGGAGGGAAGAAAGGCGG - Intronic
914430229 1:147613938-147613960 GAGGGAGGAGGGGAGGAAGGAGG - Intronic
914565948 1:148866640-148866662 GGGAGGGGAGGGAAGGAAGGAGG + Intronic
914823985 1:151127954-151127976 GTTTGGGAAGGTAAGGCAGGTGG - Intergenic
915157678 1:153891645-153891667 GTAAGAGGAGGTAAGTATGGGGG + Intronic
915318856 1:155044946-155044968 GCTTGTGGAGGGAAGGAAGGAGG + Intronic
915593691 1:156884530-156884552 GTGGGAGCAGGGCAGGAAGGAGG - Intergenic
916434080 1:164760404-164760426 GAGGGAGGAGGGATGGAAGGAGG - Intronic
916565734 1:165975118-165975140 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
916909692 1:169333318-169333340 GTGGGAGGCTGTAGGGAAGGTGG + Intronic
917923808 1:179772214-179772236 GTGAGCAGAGGAAAGGAAGGTGG - Intronic
918108545 1:181434728-181434750 GTGGGAGGAGCTACGGGAGGTGG + Intronic
918302194 1:183214670-183214692 GTGTGGAGAGGCAAGGATGGAGG + Intronic
918761869 1:188420602-188420624 GAGTGAGGAAGGAAGGAAGAAGG - Intergenic
919392966 1:197010548-197010570 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
919505916 1:198397488-198397510 ATGGAAGGAGGAAAGGAAGGAGG - Intergenic
919939867 1:202278764-202278786 GTGTGAGCAGGCAAGCAGGGTGG + Intronic
920006223 1:202835644-202835666 GTGGGAGGAGGAAATGAAGTGGG + Intergenic
920154535 1:203937653-203937675 GGGGGAGGAAGGAAGGAAGGAGG + Intergenic
920181157 1:204132283-204132305 GTGTGAGGAAGAAAGCCAGGTGG + Intronic
920289509 1:204908709-204908731 GTGCCAGGGGTTAAGGAAGGGGG - Intronic
920499776 1:206478884-206478906 GTGTCAGTAGGCAAGGCAGGGGG - Intronic
920539037 1:206763526-206763548 GGCTTTGGAGGTAAGGAAGGTGG - Intergenic
920694847 1:208174417-208174439 GTGGGAGGAGGTAAGGGCTGTGG + Intronic
920719432 1:208373317-208373339 GATTGAGGAGGTGAGGAGGGAGG + Intergenic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
921257731 1:213357397-213357419 GTGAGAGGGGGTAAGGATGTTGG + Intergenic
921343551 1:214158427-214158449 GGGTGAGGAGGCAGGGTAGGTGG - Intergenic
921959788 1:221022595-221022617 GTGTGAAGAGGGGAGGGAGGTGG - Intergenic
922348762 1:224718647-224718669 GTGGGAGGAGGCAGGGACGGGGG + Intronic
922473240 1:225889201-225889223 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
922658513 1:227407641-227407663 GGCTGAGGAGGAAAAGAAGGAGG + Intergenic
922723233 1:227909661-227909683 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
922723249 1:227909705-227909727 AGGGGAGGAGGGAAGGAAGGAGG + Intergenic
922723257 1:227909725-227909747 AGGGGAGGAGGGAAGGAAGGAGG + Intergenic
922723317 1:227909883-227909905 GAGGGAGGAGGGAAGGAAGAAGG + Intergenic
922933491 1:229407673-229407695 GTCTGTGGAGGGAGGGAAGGAGG + Intergenic
923052024 1:230395896-230395918 GCGTGAGGAGGGGAGGAGGGTGG - Intronic
923326785 1:232887024-232887046 GTGTTAGGAGGCAGAGAAGGAGG - Intergenic
923402180 1:233625892-233625914 GAGTGATGAGGTCAGGAAGAAGG + Intronic
923660998 1:235957187-235957209 GGATGAGGAGGTGGGGAAGGAGG + Intergenic
923987096 1:239393554-239393576 GGGTGAGGAGAGAAGAAAGGAGG - Intronic
924071550 1:240285415-240285437 AAGTGAGGAGTTCAGGAAGGAGG + Intronic
924202165 1:241671773-241671795 GTGGGAGGAGGTCAGGAAGAGGG + Intronic
924290350 1:242529841-242529863 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
924508484 1:244709153-244709175 GTGAGAGGAAGAAAGGATGGAGG - Intergenic
924928081 1:248702946-248702968 GAGTAAGGAGGTAAGCAAGGAGG - Intergenic
924928104 1:248703135-248703157 GAGTAAGGAGATAAGCAAGGAGG - Intergenic
1062812540 10:477463-477485 GTGGGAGGTGGGGAGGAAGGTGG + Intronic
1062812554 10:477497-477519 GTGGGAGGTGGGGAGGAAGGTGG + Intronic
1063349128 10:5338201-5338223 AAGGGAGGAGGGAAGGAAGGAGG - Intergenic
1063515430 10:6690302-6690324 GAGAGAGGAGGAAACGAAGGTGG - Intergenic
1063691895 10:8295607-8295629 GAGAGAGGAAGAAAGGAAGGAGG - Intergenic
1063711415 10:8482717-8482739 GAGAGAGGAGGGAGGGAAGGAGG - Intergenic
1063907066 10:10792043-10792065 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1064051702 10:12065429-12065451 GAGTGAGGAGATATGGGAGGAGG - Intergenic
1064272859 10:13880726-13880748 ATGTGAGGAGGTAAGCCAGGTGG - Intronic
1064340518 10:14481429-14481451 TTGTGAGGAAGGAAGGAAGGAGG - Intergenic
1064420546 10:15186953-15186975 TGGTGAGGAGGTGAGGAAGGGGG + Intergenic
1064546429 10:16454983-16455005 CTTTGAGGAGCTGAGGAAGGTGG + Intronic
1064677353 10:17774780-17774802 GAGAAAGGAGGTAGGGAAGGAGG - Intronic
1064750315 10:18521840-18521862 ATGGGAGGAGGAAAGGAATGTGG - Intronic
1064877722 10:20014233-20014255 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1064906920 10:20357085-20357107 GTGTGGGGAGGTAGGGAGGCAGG - Intergenic
1065088288 10:22203032-22203054 GCAAGAGGAGGGAAGGAAGGAGG - Intergenic
1065162906 10:22941758-22941780 GGGTGAGGAGGAAAGAAAGGGGG + Intronic
1065334816 10:24645876-24645898 GAGTGAGAAGGAAAGGAAGAGGG + Intronic
1065438360 10:25724496-25724518 GAGAAAGGAGGGAAGGAAGGAGG + Intergenic
1065550063 10:26860996-26861018 GAGTGAGGAGGAAGGGGAGGAGG - Intronic
1065616316 10:27528546-27528568 GGGTGAGGTGGTAGGAAAGGAGG - Intronic
1065626960 10:27639480-27639502 ATGGGAAGAGCTAAGGAAGGTGG + Intergenic
1066458823 10:35595518-35595540 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1067408548 10:46045071-46045093 GTGGGAGGAGCCAAGGGAGGTGG - Intronic
1067950866 10:50737848-50737870 TTTTCAGGAGGCAAGGAAGGGGG + Intergenic
1068120617 10:52779406-52779428 GCTTGAGGAGGGAGGGAAGGAGG - Intergenic
1068775362 10:60862877-60862899 GAGAGAGGAGGGAAGGAAGGAGG - Intergenic
1068810628 10:61251944-61251966 GTGGGAGGAGGGAAAGAAGCAGG - Intergenic
1068816717 10:61323622-61323644 GAGGGAGGAGGAAAGGAAGAAGG + Intergenic
1070639844 10:78160241-78160263 GGATGAGGAGGCAAAGAAGGAGG + Intergenic
1070886214 10:79903062-79903084 TTTTCAGGAGGCAAGGAAGGGGG + Intergenic
1071482892 10:86078480-86078502 GTGAGAGGAGGCAGGGCAGGGGG - Intronic
1071564027 10:86662423-86662445 GAGTGAGGTGGTAAGGATGCTGG + Exonic
1071571399 10:86699415-86699437 CTGTGTGGGGGTAAGGATGGAGG - Intronic
1071621898 10:87128151-87128173 ATGAGAGGAGGAAATGAAGGTGG - Intronic
1071712381 10:88062335-88062357 GTGTGAGGAGGTGGGGGATGGGG - Intergenic
1072161490 10:92771220-92771242 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1072220597 10:93324575-93324597 GTGAGAGGAGAGAAAGAAGGAGG + Intronic
1072454711 10:95565605-95565627 GTGTGAGGAATTAGGAAAGGAGG + Intergenic
1072767142 10:98104345-98104367 GAGAGAGGAGGAAAGGAAGGAGG - Intergenic
1072827278 10:98619876-98619898 ATGTGAGGAAGAAAGGCAGGTGG + Intronic
1073070751 10:100791764-100791786 AGGTGAGGAGGGAAGAAAGGAGG - Intronic
1073273037 10:102282966-102282988 GTGAGAGGAGGTAAAGTAGCGGG + Intronic
1073485542 10:103815990-103816012 GGGTGAGGAGGTAGGGAAAATGG + Intronic
1073546707 10:104355019-104355041 GTATGATAAGGAAAGGAAGGAGG - Intronic
1073641915 10:105261597-105261619 GTGTGAGGAGATAATGAAGATGG + Intronic
1074147718 10:110731214-110731236 GTGAGAGGAAATAAGAAAGGAGG - Intronic
1074162718 10:110847229-110847251 GGGTGAGGAGGGGAGGTAGGGGG - Intergenic
1074377140 10:112950095-112950117 GAGGGAGGAGGGAAAGAAGGAGG - Intergenic
1075065626 10:119287251-119287273 GAGAGAGGAGGAAGGGAAGGAGG + Intronic
1075065650 10:119287334-119287356 GAGAGAGGAGGAAGGGAAGGAGG + Intronic
1075804331 10:125174617-125174639 GTGGGAGGAGGGAGAGAAGGCGG - Intergenic
1075995625 10:126873993-126874015 GTGTGGAGAGGAAAGGAAGGAGG - Intergenic
1076558679 10:131346898-131346920 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1076558692 10:131346945-131346967 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1076583325 10:131529657-131529679 GTGTGAGGAGGGTGAGAAGGCGG - Intergenic
1076586207 10:131549319-131549341 GTGTGAGGATGGAGGGAACGGGG + Intergenic
1076728846 10:132428380-132428402 GTGTGAGGTGATAATGAAGACGG - Intergenic
1077272311 11:1687005-1687027 GAGGGAGGAGGCAAAGAAGGAGG - Intergenic
1077304762 11:1864088-1864110 GAGGGAGGAGGGAAGGAGGGAGG + Intronic
1077497355 11:2892616-2892638 GGATGAGGAGGGAAGGAAGGAGG - Intronic
1077657063 11:4029549-4029571 GAGAGAGGAGGGACGGAAGGAGG + Intronic
1077835352 11:5922588-5922610 GGGTGAGGGGGTAATGAGGGAGG - Intronic
1077891316 11:6419864-6419886 GTGTAAAGATGTAAGGAAGATGG + Intergenic
1078013413 11:7591899-7591921 GTGGGATGAGGGGAGGAAGGAGG + Intronic
1078249654 11:9606700-9606722 ATGTAATGAGATAAGGAAGGGGG + Intergenic
1078426460 11:11254670-11254692 GTTTGGGGATGTAAGAAAGGAGG + Intergenic
1078512107 11:11992557-11992579 GTGTGAGGTGATTAGGGAGGTGG - Intronic
1078654497 11:13225860-13225882 GTTGGAGGTGGTAAGGAGGGAGG - Intergenic
1079137690 11:17785189-17785211 GTGTGAGAAGGAAGGGAAAGAGG - Intergenic
1079161555 11:17999646-17999668 GTGTGAGGGGGACAGGGAGGTGG - Intronic
1079576784 11:22013690-22013712 GTGTGAGAACATAGGGAAGGTGG + Intergenic
1079990359 11:27240166-27240188 GTATGAGAAGGTAAGGGAGAAGG - Intergenic
1080094255 11:28385813-28385835 GTGTGAGGGGATAGGGAATGAGG + Intergenic
1080684836 11:34506335-34506357 GAGGGAGGAGGCAGGGAAGGGGG + Intronic
1081804176 11:45881288-45881310 ACGTGAGGAGGGAGGGAAGGAGG - Exonic
1081853686 11:46290793-46290815 GGGTGGGGAGGCAAGGAAGGTGG + Intronic
1082803164 11:57429164-57429186 GTGTGAGATGATGAGGAAGGAGG - Intergenic
1083209218 11:61172434-61172456 GTGGGAGGAGGTGGGGAAGATGG - Intergenic
1083308337 11:61772223-61772245 GAGGGAGGAGGTGGGGAAGGAGG - Intronic
1083407086 11:62465008-62465030 GTGAGAGGAGGAAAGCCAGGAGG - Intronic
1083549037 11:63572031-63572053 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1083713106 11:64560650-64560672 CTGTGATGAGGGAAGCAAGGAGG - Intronic
1083734475 11:64671534-64671556 GGGGGAGGAGGGAAGGGAGGGGG + Intronic
1083929737 11:65834074-65834096 GTATGCGGAGGTTGGGAAGGAGG + Exonic
1084144355 11:67256205-67256227 GTGTGTGGAGGGAGGGAGGGAGG + Exonic
1084183641 11:67458832-67458854 GTAGGAGGAGGTAAGGATGAGGG - Exonic
1084458520 11:69283421-69283443 GTGCCAGGGGCTAAGGAAGGAGG - Intergenic
1084545694 11:69813968-69813990 GTGAAAGGATGGAAGGAAGGAGG + Intronic
1084615266 11:70231615-70231637 CTGTGAGGGGGTAAGGAGGCAGG + Intergenic
1084870933 11:72098190-72098212 CTCAGAGGAGGTAGGGAAGGTGG - Intronic
1085254875 11:75166796-75166818 GTGTGAGGAGGGAAGCACAGGGG + Intronic
1085284340 11:75350363-75350385 GGGAGGGGAGGAAAGGAAGGAGG + Intronic
1085314502 11:75536169-75536191 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1085323993 11:75592819-75592841 GGGTGAAGGGGTAAGGAAGTGGG - Intronic
1085324466 11:75595884-75595906 GTTTGTGGAAGTACGGAAGGAGG - Intronic
1086313135 11:85558787-85558809 CTGTGAGGAGGTAAGGAGTCGGG + Intronic
1086525380 11:87719399-87719421 CAGGGAGGAGGTAAGGGAGGAGG - Intergenic
1087710063 11:101538443-101538465 GGTTGAGGGGGTAAGGAAAGGGG - Intronic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1090251242 11:125253427-125253449 GAGTGAGGAGGAGAGGAGGGTGG + Intronic
1090845676 11:130528056-130528078 GAGTGAGGAGGGAATGAATGCGG + Intergenic
1090884119 11:130861428-130861450 GTGGGCGGTGGTAAGGAAGGCGG - Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091325242 11:134682027-134682049 GTGTGAGGTGACAAGGAAGAGGG - Intergenic
1091326951 11:134698370-134698392 CTGTGAGGAGGTGAGGCAGCTGG - Intergenic
1091450387 12:569109-569131 GTTGGAGGAGGTAGGGATGGAGG + Intronic
1091490682 12:929965-929987 GGGTGAGGAGGTAAGGTAGGTGG - Intronic
1091917778 12:4281853-4281875 GGCTGAGCAGGGAAGGAAGGAGG - Intronic
1091976090 12:4827010-4827032 AGGAGAGGAGGAAAGGAAGGAGG - Intronic
1092046430 12:5434235-5434257 GTGTTAGGAGGTAAGGGGGTTGG + Intronic
1092228574 12:6764601-6764623 GAGGGAAGAGGAAAGGAAGGCGG + Intronic
1092747847 12:11690267-11690289 TTGTAAGGACGTGAGGAAGGGGG - Intronic
1093941844 12:25063823-25063845 GTCTGAGCAGGTATAGAAGGGGG - Intronic
1094205078 12:27831267-27831289 TCTTGAGGAGGTAAGGAAAGTGG - Intergenic
1094724018 12:33093811-33093833 GACTGAGGAGGGGAGGAAGGAGG - Intergenic
1095355212 12:41264938-41264960 AAGTGAGGAGGGAAAGAAGGAGG + Intronic
1095752760 12:45729581-45729603 GGGAGAGGAGGGAAGGAGGGAGG - Intergenic
1095999391 12:48116165-48116187 GGGAGAGGAAGAAAGGAAGGAGG - Intronic
1096330396 12:50707441-50707463 GTATGTGGAAGGAAGGAAGGAGG + Intronic
1096435026 12:51582373-51582395 GTGTTAGGAGGTAATGCAGCTGG + Intergenic
1096560059 12:52429724-52429746 GAGTGTGGTGGAAAGGAAGGTGG - Intronic
1096562735 12:52448400-52448422 GTGAGAGGATGTGAGGCAGGAGG - Intronic
1096638084 12:52973920-52973942 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1096638103 12:52973972-52973994 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1097173384 12:57129347-57129369 TTGTGAGGATGTAGGGGAGGCGG - Intronic
1097324948 12:58265994-58266016 TGGTGAGGAGGTAGGGAAGAGGG + Intergenic
1097334360 12:58365739-58365761 GGGTGAGGAGTTGGGGAAGGGGG + Intergenic
1097345564 12:58488424-58488446 GGGGGTGGAGGTTAGGAAGGGGG - Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1100106699 12:91183816-91183838 GCTGGAGGAGGGAAGGAAGGAGG - Intergenic
1100240803 12:92708878-92708900 GTGTATGGATGTAAGGAATGGGG + Intergenic
1100263720 12:92956375-92956397 GTTTGTGGAAGAAAGGAAGGAGG + Intergenic
1100892973 12:99146692-99146714 GAGTGAGGAGATCAGGCAGGTGG - Intronic
1101027887 12:100631388-100631410 GTTTGTGGAAGAAAGGAAGGAGG + Intergenic
1101181103 12:102218876-102218898 GTGTGAGAAGCAGAGGAAGGAGG - Intergenic
1101294620 12:103408386-103408408 GGGTGTGGAGGTGAGGAAGTAGG + Intronic
1101561820 12:105864142-105864164 GGGCAAAGAGGTAAGGAAGGAGG + Intergenic
1101925641 12:108969305-108969327 GGGGGAGGAAGAAAGGAAGGAGG - Intronic
1102168436 12:110824346-110824368 GAGGAAGGAGGTAGGGAAGGAGG + Intergenic
1102992023 12:117322405-117322427 AAGGGAGGAGGGAAGGAAGGAGG - Intronic
1103011507 12:117461753-117461775 GGGTGAGGTGGTACGGGAGGAGG + Exonic
1103022979 12:117551271-117551293 GAAGGAGGAGGAAAGGAAGGAGG - Intronic
1103030201 12:117606600-117606622 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1103181936 12:118920403-118920425 GTCTGTAGAGATAAGGAAGGGGG + Intergenic
1103192572 12:119014682-119014704 AAGTGAGGAGGTAAGAAGGGAGG + Intronic
1103328938 12:120140471-120140493 GTGTGAGTGGGTAGGGCAGGAGG - Intronic
1103608424 12:122105817-122105839 GAGAGAGGAGGAAAAGAAGGGGG - Intronic
1103662075 12:122528237-122528259 GAGTGAGGAGATGAAGAAGGAGG - Intronic
1103977005 12:124709399-124709421 GAGTGAGGAGGGAGGGACGGAGG - Intergenic
1104207095 12:126649691-126649713 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1104289205 12:127453544-127453566 GTGTGAGGAGGGAAGGCAGAAGG + Intergenic
1104451649 12:128873867-128873889 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1104462428 12:128966508-128966530 GTCTGAGGAGGTTGGGGAGGAGG - Intronic
1104616358 12:130273310-130273332 GGGGGAGGAGGAGAGGAAGGAGG - Intergenic
1104811335 12:131622017-131622039 GTGTGAGGAGGGAAAAAAGCCGG - Intergenic
1105405060 13:20126951-20126973 GTGAGAGGAGAGAAGGGAGGGGG - Intergenic
1105469160 13:20676233-20676255 ATGTGATGAGTTCAGGAAGGTGG - Intronic
1105626084 13:22114189-22114211 GTATTTGGAGGTAAGAAAGGTGG + Intergenic
1105742784 13:23345991-23346013 GTGTGCAGAGGAAGGGAAGGTGG - Intronic
1105891723 13:24686919-24686941 GTGAGAGCAGGGAAGGCAGGAGG + Intronic
1106589890 13:31090064-31090086 GTGGGAAAAGGTAAGGCAGGCGG - Intergenic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1107807630 13:44169153-44169175 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1107843183 13:44481283-44481305 GTGGGAGGTGGTAAGGAAAAAGG + Intronic
1107928600 13:45287811-45287833 GTGTCAGGATTTAAGGAGGGTGG - Intergenic
1108556728 13:51600702-51600724 GGGAGAGGAGGGAAGGGAGGAGG + Intronic
1108838677 13:54583963-54583985 TTGTGAGGGGTTAAGGGAGGTGG + Intergenic
1109140231 13:58705616-58705638 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1110137758 13:72089398-72089420 GTGTAAGGAAGAGAGGAAGGGGG + Intergenic
1110210091 13:72961649-72961671 GGGTGAAAGGGTAAGGAAGGGGG - Intronic
1110397804 13:75052131-75052153 GTGTGATGAGGTAATGAAGTAGG + Intergenic
1110459019 13:75723760-75723782 GAGTGAGAAGAAAAGGAAGGAGG + Intronic
1110474635 13:75899823-75899845 CTGTGAGAAGCTAAGGAGGGCGG + Intergenic
1111452646 13:88438831-88438853 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1111696464 13:91630793-91630815 GTGGGAGGAGGAAAGAAAGGGGG + Intronic
1111792024 13:92869549-92869571 GAGGGAGGAGGGAGGGAAGGAGG + Intronic
1112037302 13:95508571-95508593 TTGCCATGAGGTAAGGAAGGCGG + Intronic
1112544651 13:100354340-100354362 GTGGGAGGAGGGAGGGAGGGAGG + Intronic
1113185528 13:107682417-107682439 GTGTTAGGCGCTGAGGAAGGAGG - Intronic
1113591604 13:111505356-111505378 GTCTGTGGATGTGAGGAAGGGGG - Intergenic
1113600196 13:111563200-111563222 GTGAGAGGAGGGACGGAAAGAGG - Intergenic
1113600212 13:111563250-111563272 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600236 13:111563325-111563347 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113666318 13:112143944-112143966 ATGTGAGGAGGTGAGGACTGTGG + Intergenic
1113894546 13:113755294-113755316 GAGTGAGTAGAGAAGGAAGGTGG + Intergenic
1113909805 13:113836544-113836566 GGGGGAGGAGGTGAGGGAGGGGG + Intronic
1114056425 14:18971580-18971602 GTGGGAGGAGGGAAAGAAGCAGG + Intronic
1114106125 14:19430147-19430169 GTGGGAGGAGGGAAAGAAGCAGG - Intronic
1114301074 14:21378619-21378641 GTATCAGGAGGTAGGGAAGTTGG + Intronic
1114317646 14:21523131-21523153 GTTTTAGGAGGCAAGGAAGAGGG - Exonic
1114435370 14:22702229-22702251 GTGTGAGGAGGTAGGTCAGGAGG - Intergenic
1115026958 14:28757192-28757214 ACGTGAGGAGGAAAGGGAGGGGG + Intergenic
1115190024 14:30738082-30738104 GAGGGAGGAGGAAGGGAAGGGGG + Intergenic
1117253607 14:53956887-53956909 GAGGGAGGAGGGAAGGAGGGAGG - Intronic
1117517641 14:56518341-56518363 GAGGGAGGAAGAAAGGAAGGAGG - Intronic
1117766303 14:59086918-59086940 GGGGGAGGAGGGAAGTAAGGGGG + Intergenic
1117869358 14:60183734-60183756 GTGTGAGAATGCAAGCAAGGAGG + Intergenic
1117870373 14:60194464-60194486 CTCTGAGGAGGGAAGGAAAGAGG + Intergenic
1117979283 14:61326425-61326447 GAGAGTGGAGGTAAGGGAGGTGG + Intronic
1119203988 14:72780347-72780369 GTGAGCAGAGATAAGGAAGGTGG - Intronic
1119809566 14:77505420-77505442 GTGTGGGGAGGTGAGGTAGTGGG - Intergenic
1120005687 14:79355257-79355279 GAGGAAGGAGGGAAGGAAGGGGG - Intronic
1120727094 14:87956262-87956284 GTGTGTGGAGGGGAAGAAGGAGG + Intronic
1120858633 14:89234751-89234773 GTGTGAGCTGGTAAGGAAAGTGG + Intronic
1121830712 14:97049702-97049724 GTGTGAGGTGCTATGGAAGGTGG + Intergenic
1121843866 14:97156274-97156296 CTGAGAGGAAGAAAGGAAGGAGG - Intergenic
1121941798 14:98077823-98077845 GTGTGATGATTTTAGGAAGGGGG - Intergenic
1122092876 14:99351753-99351775 GTGTGAAGAGGGAAGGGAGGTGG - Intergenic
1122546021 14:102523360-102523382 GTGGCAGGAAGGAAGGAAGGAGG + Intergenic
1122857555 14:104567189-104567211 GTGGGTGGAGGCAAGGAAGCCGG - Intronic
1122866307 14:104605726-104605748 GTGTGATGGGGTAGGGGAGGGGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1123146418 14:106135050-106135072 GTGGAAGGAGATAAGGAACGTGG - Intergenic
1123972705 15:25523422-25523444 GTGGGAGGAGGTAGGAAAGAGGG + Intergenic
1125508492 15:40280943-40280965 GTGGGAGAAGGAAAGGACGGAGG - Intronic
1125510937 15:40291932-40291954 GGGAGAGCAGGTCAGGAAGGTGG + Intronic
1125703849 15:41713408-41713430 GGGAGAGGAGGCAAGGGAGGAGG + Exonic
1125709131 15:41769649-41769671 GTGAGAGGAGTTGAGGAACGTGG + Exonic
1125729443 15:41884740-41884762 GGGTGACGAGGTAGGGAAGGAGG - Intronic
1125816995 15:42594162-42594184 GTGTGAGGATGTCAGGAACCTGG + Intronic
1125916474 15:43492724-43492746 GAGAGAAGAGGTTAGGAAGGAGG - Intronic
1126138751 15:45418835-45418857 GTGTGGGGTGGTGAGGAGGGTGG + Intronic
1126145124 15:45466708-45466730 GTGAGAGGAGGGATGGAAGCAGG + Intergenic
1126171245 15:45696979-45697001 GGAGGAGGAGGAAAGGAAGGAGG - Intergenic
1126741930 15:51786172-51786194 GAGTGAGGAGGGGAGGAGGGTGG - Intronic
1127134852 15:55909578-55909600 ATGTGTTGAGGTCAGGAAGGTGG - Intronic
1127164425 15:56229975-56229997 GTGAGGGCAGATAAGGAAGGAGG - Intronic
1127221794 15:56887595-56887617 GTGTGGGGAGGAAGGAAAGGTGG + Intronic
1127585690 15:60375943-60375965 GTTTGAGGTGGGGAGGAAGGAGG + Intronic
1127911064 15:63416691-63416713 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1129121444 15:73399283-73399305 GTGGGAGGAGCTTAGGAAGTAGG - Intergenic
1129160569 15:73745368-73745390 GAGTGAGTAGGAAAGGAGGGAGG - Intronic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1129737047 15:77972323-77972345 GTGTGCGGAGGTGGGGAGGGTGG + Intergenic
1129849033 15:78781312-78781334 GTGTGCGGAGGTGGGGAGGGTGG - Intronic
1129975841 15:79821000-79821022 ATGTGAGGAGATAAGGCAAGAGG - Intergenic
1130252754 15:82311310-82311332 GAGGGAGGAGGGAAGGAGGGAGG - Intergenic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130610289 15:85354901-85354923 GTCTGGGAAGCTAAGGAAGGAGG + Intergenic
1130908714 15:88256883-88256905 GTGTGGGGAGGGGAGGGAGGGGG - Intergenic
1130949640 15:88575347-88575369 GTGTGAGGAGTCTTGGAAGGTGG + Intergenic
1131311069 15:91290274-91290296 ATGTGAAGAGGTAAGGAAGGTGG + Intronic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1131835274 15:96384093-96384115 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1132021063 15:98363241-98363263 GAGAGAGGAGGCAAGGAGGGAGG + Intergenic
1132064743 15:98721500-98721522 GGGGGAGGAGGAAGGGAAGGAGG + Intronic
1132322482 15:100936119-100936141 GAGTGACGAGTAAAGGAAGGAGG + Intronic
1132855543 16:2043025-2043047 GAGTGGGGAGGTAAGGACTGAGG - Intronic
1133238452 16:4400900-4400922 GGGGGAGGAGGTAAGGAATATGG + Intronic
1133254852 16:4510348-4510370 GTGCCAGGAGGCAGGGAAGGAGG - Intergenic
1133320300 16:4909375-4909397 GGGTGGGGAGGTCAGGAGGGAGG - Intronic
1133392820 16:5422987-5423009 GAGGGAGGAGGGGAGGAAGGAGG + Intergenic
1133550049 16:6845729-6845751 GTGTATGGGGGTCAGGAAGGAGG - Intronic
1133729781 16:8569439-8569461 GGGTGAGGAGGAAATGAAGTCGG + Intergenic
1134811623 16:17172184-17172206 GAGAGAGGAGGGAAGGAAGGAGG - Intronic
1134948710 16:18342124-18342146 GGGGGAGGAGGGGAGGAAGGAGG + Intergenic
1135110924 16:19690314-19690336 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
1135860510 16:26051752-26051774 GTGTGGGGTGGGGAGGAAGGAGG - Intronic
1136083642 16:27869021-27869043 GAGGGAGGAGGGAAGGAAGGAGG + Intronic
1136170711 16:28487548-28487570 GGGTGAGAAGGGAAGGGAGGGGG + Intronic
1136540918 16:30927340-30927362 GTGTGGGGAGGCTGGGAAGGAGG + Exonic
1136555844 16:31007435-31007457 GAGTGAGGTGGAGAGGAAGGTGG - Intronic
1136692646 16:32046459-32046481 GTGGAAGGAGATAAGGAACGTGG + Intergenic
1136793143 16:32989685-32989707 GTGGAAGGAGATAAGGAACGTGG + Intergenic
1136876710 16:33864372-33864394 GTGGAAGGAGATAAGGAAAGTGG - Intergenic
1137482150 16:48861354-48861376 TTTTCAGGAGGGAAGGAAGGGGG + Intergenic
1137774050 16:51040994-51041016 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
1137860330 16:51840380-51840402 AGGGGAGGAGGAAAGGAAGGTGG + Intergenic
1139578508 16:67857613-67857635 ATGTTAGGAGGTAATGAATGGGG - Intronic
1139644652 16:68319468-68319490 GTGTGAAGAGGCCAGGAAGGTGG + Intronic
1140187354 16:72787369-72787391 GAGAGAGGAGGAAAAGAAGGGGG + Exonic
1140693127 16:77503869-77503891 GAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1140732720 16:77871214-77871236 GTGGGAGGAGGTAGGGGAGGTGG - Intronic
1140944638 16:79756511-79756533 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1141147613 16:81542771-81542793 GTTTGAGGAGGTCATGAAGTTGG - Intronic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1141490675 16:84370485-84370507 GTGTGAGGAGGGAGGGAGGTGGG + Intronic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141732863 16:85834200-85834222 GAGGGAGGAGGGAGGGAAGGAGG + Intergenic
1142264490 16:89057525-89057547 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142264518 16:89057615-89057637 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142338825 16:89507935-89507957 GTGTGAGGAGCGCAGGAAGGGGG - Intronic
1203095399 16_KI270728v1_random:1251376-1251398 GTGGAAGGAGATAAGGAACGTGG + Intergenic
1142553253 17:753472-753494 GAGTGAGGAGATGAGGAAGAAGG + Intronic
1143673721 17:8415088-8415110 GAGGGAGGAAGAAAGGAAGGTGG - Intronic
1143701115 17:8660902-8660924 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1144726016 17:17503144-17503166 GTGTCAGGAGGTGAGGCAGTGGG - Intergenic
1144995413 17:19264882-19264904 GTGGGAGGAAGGAAGGAGGGTGG + Intronic
1145764100 17:27446154-27446176 ATGGGAGGAAGGAAGGAAGGAGG + Intergenic
1145890172 17:28408518-28408540 GTGCCAGGAAGCAAGGAAGGAGG - Intergenic
1145931425 17:28688574-28688596 GTATAAAGAGATAAGGAAGGGGG + Intronic
1146485772 17:33241402-33241424 GTGAGAGCAGAGAAGGAAGGGGG - Intronic
1146624940 17:34428026-34428048 GTCTGAGGAGGGAGGGAGGGAGG - Intergenic
1146651099 17:34606901-34606923 GGCGGAGGAGGAAAGGAAGGAGG - Intronic
1146680840 17:34806922-34806944 ATATGAGGAGGTAAGGAAGAGGG + Intergenic
1146749772 17:35368148-35368170 GTGGGAGGATGGAAGGAAAGGGG - Intronic
1147314351 17:39612464-39612486 GGGGGAGGAGGAAAGGGAGGGGG + Intergenic
1147444138 17:40464488-40464510 TTGGGAGGAAGGAAGGAAGGGGG + Intergenic
1147919534 17:43907407-43907429 GTGTCAGGACGAAAAGAAGGCGG + Intronic
1148044194 17:44732407-44732429 GTGGGAGGATGTGGGGAAGGGGG + Intronic
1148340008 17:46867717-46867739 GTGAAAGGAGGTGGGGAAGGAGG + Intronic
1148464422 17:47856474-47856496 GGGTGAAGAGGGTAGGAAGGTGG + Intergenic
1148473005 17:47907162-47907184 GAGTGAGTAGGGAAGGAGGGAGG + Intronic
1149083866 17:52691016-52691038 CTGTTTGGAGGTAGGGAAGGAGG + Intergenic
1150041323 17:61864112-61864134 GTCTTAGGAGGGATGGAAGGCGG - Intergenic
1150293141 17:63993203-63993225 AAGGGAGGAGGGAAGGAAGGAGG + Intergenic
1150293148 17:63993222-63993244 GAGGGAGGAGGGAAGGAAGGAGG + Intergenic
1150859452 17:68786338-68786360 GTGAGAGGAAGGAAGGAGGGAGG - Intergenic
1150999097 17:70352596-70352618 GTGTGAGGAGGAGAGTAAGGTGG - Intergenic
1151383871 17:73743449-73743471 GAGGGAGGAGGTGGGGAAGGGGG - Intergenic
1151441502 17:74132305-74132327 TTGTGAGGAGGGAGGGAAAGAGG + Intergenic
1151484504 17:74389915-74389937 AAGGAAGGAGGTAAGGAAGGGGG - Intergenic
1151484543 17:74390189-74390211 AAGGAAGGAGGTAAGGAAGGGGG - Intergenic
1151748627 17:76024552-76024574 GTGCGAGGAGGTGGGGATGGGGG - Intronic
1152273684 17:79341362-79341384 GTATGAGGAAGTAAAAAAGGAGG - Intronic
1152368317 17:79870212-79870234 GTGGGAGGAGGAAGGGCAGGTGG - Intergenic
1152464088 17:80456132-80456154 GGGTGAGGGGGTGAGGTAGGGGG + Intergenic
1152658911 17:81533436-81533458 CGGTGAGGAGGTAAGAACGGAGG - Intronic
1153434955 18:5059184-5059206 GTGTGGTGAGGCAGGGAAGGAGG - Intergenic
1153559591 18:6358620-6358642 GTTTGAGGAGCACAGGAAGGTGG - Intronic
1153647221 18:7205974-7205996 GAGAGAGGAGGAAAGGAAAGGGG - Intergenic
1155449299 18:25946757-25946779 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1155449312 18:25946806-25946828 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156490212 18:37491634-37491656 GAGTGAGGAGGGAAGGGAGAAGG + Intronic
1156691703 18:39715204-39715226 GTGAGAGAAGGCCAGGAAGGTGG - Intergenic
1156791760 18:40984112-40984134 GGGGGAGGAGGAAAGGCAGGGGG - Intergenic
1157095290 18:44680834-44680856 GGGGGAGGGGGTAAGGAAAGGGG + Intronic
1157100206 18:44722348-44722370 GTGTGAGAAGGTAGGGCAGCAGG - Intronic
1157192830 18:45595792-45595814 GTGTGTGGAAGTGAGGAAGCCGG - Intronic
1157279743 18:46338524-46338546 GTGTGTTGAGGTGGGGAAGGGGG + Intronic
1157287944 18:46390125-46390147 GGGTGGGGAGGTCAGGAAGAGGG - Intronic
1157474204 18:48011080-48011102 GTGTGAGGAGGTGGGGAGGTAGG + Intergenic
1157488648 18:48107298-48107320 GAGTGAGGAGGGATGGGAGGAGG + Intronic
1157494076 18:48142800-48142822 GAGGGAGGAGTGAAGGAAGGAGG - Intronic
1157542904 18:48524838-48524860 CTGTGAGGAGGCAAGGAGGCAGG - Intergenic
1157762861 18:50276893-50276915 GAGTGGTGAGGTCAGGAAGGAGG - Exonic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158525452 18:58209202-58209224 GGAGGAGGAGGTAAGGGAGGAGG - Intronic
1158855851 18:61542814-61542836 GTGAGAGGAAGCAAGGCAGGAGG + Intronic
1159343597 18:67169346-67169368 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1159356018 18:67338099-67338121 GAGAGAGGAGGGGAGGAAGGAGG - Intergenic
1159374222 18:67571541-67571563 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1159527910 18:69617629-69617651 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
1159549559 18:69880236-69880258 GAGAAAGGAAGTAAGGAAGGCGG + Intronic
1160433997 18:78832151-78832173 GGCTGAGGAGGGAAGGAGGGTGG - Intergenic
1160434036 18:78832293-78832315 GGCTGAGGAGGGAAGGAGGGTGG - Intergenic
1160573171 18:79832223-79832245 GGATGAGCAGGTGAGGAAGGAGG - Intergenic
1160709631 19:545047-545069 GAGGGAGGAGGGAAGGAGGGGGG - Intronic
1160872128 19:1282365-1282387 GTATGAAGGGGGAAGGAAGGAGG + Intergenic
1161028849 19:2048779-2048801 GGGGGAGGAGGGAAGGAAGGGGG + Intronic
1161139679 19:2639950-2639972 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
1161141646 19:2651413-2651435 GAGGGAGGAAGAAAGGAAGGAGG - Intronic
1161398840 19:4058875-4058897 CTGGAAGGAGGGAAGGAAGGCGG - Intronic
1162740837 19:12772714-12772736 GGGTGAGGTGGGGAGGAAGGAGG + Intronic
1162761518 19:12891412-12891434 GAGTGTGGAGGGAAGGAGGGAGG + Intronic
1162780079 19:13002375-13002397 GGGGGAGGTGGTGAGGAAGGGGG - Intronic
1162826497 19:13255677-13255699 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1162879707 19:13648951-13648973 GGGGGAGGGGGGAAGGAAGGAGG + Intergenic
1163207227 19:15812564-15812586 GAGTGAGGAAGGAAGAAAGGAGG + Intergenic
1164452956 19:28382417-28382439 GTGTGGGGAAGGAAGGGAGGTGG - Intergenic
1164588810 19:29494853-29494875 GGGTGAGGAGGGAGGGAGGGAGG + Intergenic
1164638179 19:29806617-29806639 GTGTGATGAGGTTGGGGAGGTGG - Intergenic
1164730964 19:30504291-30504313 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1165031100 19:32998826-32998848 GTGAGGGGAGGAGAGGAAGGAGG + Intronic
1165339546 19:35200962-35200984 ATGTCAGGAGGTAATTAAGGTGG - Intergenic
1165643379 19:37409761-37409783 GAGTGAGGAGGACAGGAAGATGG + Intergenic
1165694037 19:37886740-37886762 GGAGGAGGAGGAAAGGAAGGAGG - Exonic
1166571393 19:43799101-43799123 GTGAGAGGAAGGAGGGAAGGAGG - Intronic
1166590012 19:43988798-43988820 GAGAGGGGAGGTAAGGAAGTGGG - Intronic
1166631698 19:44412431-44412453 GTGTGAGGACGGAATGCAGGAGG - Intergenic
1166636479 19:44456190-44456212 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1167083965 19:47296487-47296509 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1167153944 19:47726646-47726668 GAAAGAGGATGTAAGGAAGGAGG - Intronic
1167158807 19:47754932-47754954 GTGGGAGGAAGGAAGGAAGGGGG - Intronic
1167191203 19:47991458-47991480 GAAGGAGGAGGAAAGGAAGGAGG - Intronic
1167327828 19:48836269-48836291 GTGTGAGAAAGGAAGGATGGGGG - Intronic
1167537736 19:50065753-50065775 GTGTGAGCAGGGGAGGGAGGGGG + Intergenic
1167603464 19:50467543-50467565 GTGGGAGGAGGTGAGGAGAGGGG - Intronic
1167609011 19:50497238-50497260 GAGTGAGGAAGGAAAGAAGGAGG + Intergenic
1167609894 19:50501940-50501962 ATTTGAGGAGGTGATGAAGGAGG - Intergenic
1168276041 19:55279386-55279408 GAGTGAGGAGGTAAAGGATGGGG - Exonic
1202648546 1_KI270706v1_random:161212-161234 GTGTGAGGAAGGAATGCAGGAGG + Intergenic
925091560 2:1160685-1160707 GTGAGAGGAGGTGATGAAGATGG + Intronic
926010043 2:9400281-9400303 GGGGGAGGAAGGAAGGAAGGAGG - Intronic
926244633 2:11113677-11113699 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
926579088 2:14615157-14615179 ATGGAAGGAAGTAAGGAAGGAGG + Intergenic
926890329 2:17634000-17634022 GTCTGAGGAGGTGAGGGTGGTGG + Intronic
927003231 2:18821494-18821516 ATGGGGGGAGGAAAGGAAGGAGG + Intergenic
927402280 2:22726475-22726497 GAGTGGGGAGGTGAGGGAGGGGG - Intergenic
927524358 2:23723418-23723440 GGGAGAGGAGGAAAGAAAGGAGG + Intergenic
927875967 2:26655317-26655339 GAGGGAGGGGGGAAGGAAGGAGG + Intergenic
927877811 2:26670501-26670523 GTGGGAGAAGGGAAGGAAGGAGG + Intergenic
927997138 2:27494534-27494556 GTGCGAGCAGGTAAGTAAAGGGG - Exonic
928105596 2:28468732-28468754 GGGGGAGGAGGGAGGGAAGGGGG + Intronic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
928681982 2:33712126-33712148 GAGAAAGGAGGTAAGGAAAGTGG - Intergenic
929083604 2:38146649-38146671 GTGGGGGGAGGTGAGGCAGGAGG - Intergenic
929420205 2:41782618-41782640 GTTTGGGGAGGTAAGGTAGTGGG - Intergenic
929448963 2:42023968-42023990 GAGGGAGGAAGAAAGGAAGGAGG + Intergenic
929451993 2:42044112-42044134 GAGAGAGGAGGGAAGGAAGGAGG + Intergenic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929584231 2:43103607-43103629 GTGGAAGGAGGAAGGGAAGGGGG + Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
929676136 2:43931891-43931913 GACTGAGAAGGAAAGGAAGGAGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
930366569 2:50446578-50446600 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931316609 2:61139040-61139062 GAGGGAGGAGGGAGGGAAGGAGG - Intergenic
931629425 2:64285597-64285619 GTGATAGGAGGGAAGAAAGGAGG - Intergenic
931668590 2:64627300-64627322 CTGTGAGGCCCTAAGGAAGGAGG + Intergenic
931842921 2:66173438-66173460 GGGTGAGGTGGGAGGGAAGGGGG + Intergenic
932194687 2:69773325-69773347 AAGTGAGGAGGCAGGGAAGGGGG - Intronic
932243338 2:70175325-70175347 GTGGGAGGAGGGAGGAAAGGTGG - Intronic
932442930 2:71749274-71749296 GTGTCCTGAGGTAGGGAAGGTGG + Intergenic
932624523 2:73286760-73286782 GAAGGAGGAGGGAAGGAAGGTGG - Intergenic
932648918 2:73533637-73533659 GTGTAAGGAGGTAGGGAAGTTGG + Intronic
932759482 2:74430041-74430063 GTGGGAGGAAGAAAGGAGGGTGG + Intronic
932841601 2:75088310-75088332 GCGTGGAGAGGGAAGGAAGGAGG - Intronic
933337363 2:80975541-80975563 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
934017904 2:87908789-87908811 ATGTCAGGAGGTAATAAAGGGGG + Intergenic
934035863 2:88088117-88088139 GTGGGAGGAGGGAAGGAAAGAGG - Intronic
934094272 2:88584754-88584776 GGGAGAGGAGGTAAGGAACAAGG + Intronic
934974462 2:98790908-98790930 GTATGAGAAGGAAAGGATGGAGG - Intergenic
935934723 2:108169152-108169174 GTGTTAGGAGGTGGGGAAGTGGG - Intergenic
937089374 2:119195846-119195868 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
937092328 2:119214694-119214716 CTGTGTGGAGGTAAGGCAGTGGG + Intergenic
937399548 2:121570175-121570197 GGGTGGGGAGGGAAAGAAGGAGG - Intronic
937556377 2:123162708-123162730 GTGAGAGGAAGGAAGGAAGAAGG - Intergenic
937687394 2:124713179-124713201 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
937892424 2:126948680-126948702 GTGTGAGGAGGCAATGCACGTGG + Intergenic
937907900 2:127061236-127061258 GAGTGGGGAGGTTAGGACGGTGG - Intronic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938285880 2:130116483-130116505 GTGGGAGGAGGGAAGGAAGCAGG - Intronic
938416374 2:131106186-131106208 GTGGGTGGAGGAAAGGAATGAGG + Intronic
938429725 2:131222419-131222441 GTGGGAGGAGGGAAGGAAGCAGG + Intronic
938474545 2:131595605-131595627 GTGGGAAGAGGGAAGGAAGCAGG + Intergenic
938541311 2:132286244-132286266 GTGTGAGGATGGAATGCAGGAGG + Intergenic
938780777 2:134582829-134582851 CTGAGAGGAGGAAAGGTAGGGGG + Intronic
939175777 2:138746027-138746049 GGGAGAGGAGACAAGGAAGGTGG + Intronic
939525720 2:143291389-143291411 GAGTGAGGAGGGAGGGAGGGAGG - Intronic
940279171 2:151971873-151971895 ATCTGTGGAGGTGAGGAAGGTGG - Intronic
940368956 2:152878955-152878977 GTGAGAGGAGGTACGGACAGAGG - Intergenic
941099725 2:161282397-161282419 GTGTGAGGATGGAATGCAGGAGG - Intergenic
941364174 2:164590029-164590051 GCCTTTGGAGGTAAGGAAGGTGG - Intronic
941654855 2:168132482-168132504 GTGTGGGGAGATGAGGATGGAGG - Intronic
941754795 2:169173592-169173614 ATGTTATGAGGTAGGGAAGGTGG - Intronic
942127761 2:172844492-172844514 CTGTAAGGAGGAGAGGAAGGAGG - Intronic
942329395 2:174806127-174806149 GGGGGAGGGAGTAAGGAAGGTGG + Intronic
942629429 2:177939489-177939511 GAGGGAGGAGGGAAGGAGGGAGG + Intronic
944541945 2:200762521-200762543 GTTTGCGTAAGTAAGGAAGGAGG - Intergenic
944775585 2:202960790-202960812 GAAAGAGGAGGGAAGGAAGGAGG - Intronic
945212113 2:207394493-207394515 TTGCGAGGAGGTTAGAAAGGAGG + Intergenic
945655351 2:212616537-212616559 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946138641 2:217669133-217669155 GTGTAAGGAACTAAGGAAGGGGG - Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947030117 2:225783227-225783249 AAGGGAGGAGGAAAGGAAGGGGG - Intergenic
947030189 2:225783446-225783468 GAGTGAGAAAGGAAGGAAGGGGG - Intergenic
947502840 2:230683804-230683826 TTGTGAGTGGGTAAGAAAGGAGG + Intergenic
947872880 2:233449539-233449561 GTGAGAGGAGGGGTGGAAGGAGG - Intronic
948856923 2:240734594-240734616 GTGTGAGGAGTCCAGGAAGCTGG + Intronic
1168958332 20:1850067-1850089 GGGTGGGGAGGTGGGGAAGGAGG + Intergenic
1169104586 20:2983661-2983683 GTGTGAGGAAGAAATCAAGGGGG + Intronic
1169516861 20:6326219-6326241 GGGTGTGGAGGGAGGGAAGGTGG + Intergenic
1170389889 20:15860745-15860767 GGGTGGGGAGGTAAAGGAGGAGG - Intronic
1170729667 20:18962436-18962458 GAGGGAGGAGGGAAGGAATGGGG - Intergenic
1171121336 20:22571574-22571596 GAGAGAGGAGGCAGGGAAGGAGG + Intergenic
1171179568 20:23082720-23082742 GGGTAAGGAGGGAAGGAAGAGGG - Exonic
1171486857 20:25491588-25491610 GAGGGAGGAGGCTAGGAAGGGGG - Intronic
1171785820 20:29463965-29463987 GAAAGAGGAGGGAAGGAAGGAGG - Intergenic
1171870218 20:30519266-30519288 GTGTGAGGATGGAATGCAGGAGG + Intergenic
1172236394 20:33378794-33378816 GTGTGGGGTGGACAGGAAGGAGG - Intronic
1172428343 20:34871523-34871545 GGGTGAGGAGATAATGAAGATGG - Intronic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173188885 20:40861498-40861520 GTGGGAGGAGGGAAGGCATGAGG - Intergenic
1173427899 20:42958440-42958462 GGGTGAGGAGGAAAGGAGGGGGG + Intronic
1173649294 20:44652691-44652713 CCGGGAGGAGGTAAGGACGGAGG + Intergenic
1173708871 20:45137074-45137096 GAGGGAGGAGAGAAGGAAGGAGG - Intergenic
1174174355 20:48635701-48635723 GACAGAGGAGGGAAGGAAGGTGG - Intronic
1174306647 20:49618194-49618216 GAGTGCGGAGATAAGGAAGGAGG - Intergenic
1174391794 20:50222296-50222318 GAGTGAGCAAGTAAGAAAGGAGG - Intergenic
1174817285 20:53697702-53697724 GGGAGAGGAGGGAGGGAAGGAGG + Intergenic
1175293166 20:57891608-57891630 GTGGGAGGCGGGAAGGGAGGAGG + Intergenic
1175294349 20:57898026-57898048 GTGGGAGCAGGTAAGGGAGATGG - Intergenic
1175379506 20:58553097-58553119 GAGTGTGGAAGTAAGGAAGAAGG - Intergenic
1175474910 20:59265361-59265383 GAGGGAGGAAGAAAGGAAGGAGG - Intergenic
1175553028 20:59829114-59829136 GTGTGAGGAGGTGGGGAACAGGG + Intronic
1175876519 20:62232808-62232830 GGGAGAGGAGGTCAGGGAGGGGG - Intronic
1176003138 20:62843143-62843165 CGGTGAGGAAGAAAGGAAGGGGG + Intronic
1176132068 20:63500372-63500394 GTGTGAGGAGGAAGGAAAGGTGG + Intergenic
1176160622 20:63645971-63645993 GAGAGAGGAAGAAAGGAAGGAGG + Intronic
1176603307 21:8811475-8811497 GTGTGAGGACGGAATGCAGGAGG - Intergenic
1176670369 21:9728416-9728438 GTGTGAGGGGGAGAGGAAGACGG + Intergenic
1176909740 21:14550178-14550200 ATGGGAGGAGTTAAGGAAGTGGG + Intronic
1176946605 21:14989786-14989808 GTGTGTGGAGGTGAGGAGGAGGG + Intronic
1177144986 21:17397780-17397802 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1177368484 21:20170508-20170530 CTGTAAGGAGTTCAGGAAGGAGG - Intergenic
1178002141 21:28174322-28174344 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1178061549 21:28858572-28858594 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1178061565 21:28858617-28858639 GGGAAAGGAGGGAAGGAAGGAGG + Intergenic
1178895212 21:36551949-36551971 GTGGGAGGAAGTAGGAAAGGAGG + Intronic
1179344431 21:40543581-40543603 GTCTGTGGAGGAAAGGAATGGGG + Intronic
1179428194 21:41298938-41298960 GAGTGGGGAGGGAAGGCAGGGGG + Intergenic
1179452409 21:41475200-41475222 GAGTGAGGAGGTGAGTGAGGGGG + Intronic
1179452508 21:41475547-41475569 GGGTGAGGAGGTGAGTGAGGAGG + Intronic
1179629220 21:42666345-42666367 GTGTGAGGCTGTGGGGAAGGAGG + Intronic
1180345592 22:11703032-11703054 GTGTGAGGACGGAATGCAGGAGG - Intergenic
1180352122 22:11814280-11814302 GTGTGAGGACGTAATGCAGGAGG + Intergenic
1180384880 22:12171084-12171106 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1180386086 22:12177786-12177808 GTGTGAGGACGTAATGCAGGAGG - Intergenic
1180410048 22:12598426-12598448 GTGTGAAATGGTTAGGAAGGTGG + Intergenic
1180474911 22:15694191-15694213 GTGGGAGGAGGGAAAGAAGCAGG + Intronic
1180725019 22:17940400-17940422 GTCTGAAGAAGGAAGGAAGGAGG + Intronic
1181048325 22:20227048-20227070 ATGTGAGGGGGTCAGGAGGGAGG + Intergenic
1181744510 22:24946516-24946538 GAGTGAGGAGGGAAGGAAACTGG - Intronic
1181820613 22:25472504-25472526 GTGTGAGGAGTTGGGGAAAGAGG + Intergenic
1182103268 22:27672001-27672023 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183245356 22:36689076-36689098 ATTTGAGGAGGTCAGGAAAGAGG - Intronic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1183698814 22:39438209-39438231 GAGGGAGAAGGGAAGGAAGGAGG - Intergenic
1183877259 22:40793989-40794011 GTGTAAGGAGAGAAGGGAGGTGG + Intronic
1184249801 22:43253622-43253644 GGGTCAGGAGGTGAGGAGGGAGG - Intronic
1184270784 22:43381710-43381732 GTGTGAGTTGGTAAGGAACCAGG + Intergenic
1184749232 22:46474736-46474758 ATCTGGGGAGGTGAGGAAGGAGG - Intronic
1184799529 22:46751313-46751335 GCCTGAGGAGGAGAGGAAGGAGG - Intergenic
1184843394 22:47065853-47065875 GCGTGGGGTGGGAAGGAAGGAGG + Intronic
1184852692 22:47129798-47129820 GTGTGAGGAGGCTGGGATGGAGG - Intronic
1184860884 22:47172828-47172850 GTGTGAGGTGGTCATGCAGGAGG + Intronic
1185198036 22:49484606-49484628 GTCAGAGGAGGTCAGGAAAGTGG + Intronic
949231252 3:1753837-1753859 GTGTTACGATGTAAGCAAGGAGG - Intergenic
949920506 3:8996545-8996567 GTGTTGGGAGAGAAGGAAGGAGG + Intronic
950190694 3:10974325-10974347 GTGTGAGGAAGGAAGAGAGGAGG - Intergenic
950726671 3:14921462-14921484 ATGTGGGGAGATGAGGAAGGTGG + Intronic
951376824 3:21928313-21928335 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
951949734 3:28186544-28186566 GTGAGAGAAGAAAAGGAAGGCGG - Intergenic
952089259 3:29864883-29864905 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
952271050 3:31831769-31831791 GTTTGTGGAGGTAAAAAAGGTGG + Intronic
952358517 3:32606426-32606448 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
952449062 3:33413763-33413785 GTGGGTGCAGGTAAGGAAGATGG - Intronic
952664359 3:35886563-35886585 GTGCTAGGAGTTAAGGAATGGGG - Intergenic
952705974 3:36378477-36378499 GGGTGGGGTGGAAAGGAAGGAGG + Intergenic
952923975 3:38308012-38308034 GTATGAGGGAGTTAGGAAGGAGG - Intronic
953439253 3:42904112-42904134 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
953682927 3:45052945-45052967 ACGTGATGAGGTGAGGAAGGGGG - Intergenic
953979311 3:47405789-47405811 GTCTGAGGAGGTGAGGAGAGGGG + Exonic
954405078 3:50341031-50341053 GTGTGAGGAGGGGACGAAGGAGG - Intergenic
954477739 3:50764702-50764724 GGGTGAGGGGGTGAGGCAGGAGG + Intronic
954638043 3:52082167-52082189 GGGTGAGGAGGGAAGGAAGAGGG + Intronic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
955102901 3:55869520-55869542 ATTTGGGGAGGTAAAGAAGGGGG - Intronic
955617983 3:60829197-60829219 GTGTTGGGAGGTAAGGATGCAGG - Intronic
955977363 3:64491221-64491243 ATGTGAGAAGGTAAGCAAGCAGG + Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
957566446 3:81890478-81890500 CTGGGAGGAGGCAAGTAAGGTGG - Intergenic
959185256 3:103038658-103038680 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
959240894 3:103792444-103792466 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
959368107 3:105488740-105488762 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
959584363 3:108012356-108012378 GAGGGAAGAGGAAAGGAAGGAGG + Intergenic
960897788 3:122523555-122523577 GAGTGAGAAAGGAAGGAAGGAGG - Intergenic
961082104 3:124035174-124035196 GAGGAAGGAGGGAAGGAAGGAGG - Intergenic
961175835 3:124834500-124834522 GGGAGAGGAGGGAAGGAAGGAGG + Intronic
961340136 3:126212324-126212346 ATGGAAGGAGGGAAGGAAGGAGG + Intergenic
961345425 3:126260581-126260603 GAGGGAGGAGGTTAGGCAGGAGG - Intergenic
961638846 3:128352165-128352187 GTGTCAGGAGGTGAGGATGGGGG - Intronic
961658941 3:128458181-128458203 GTGTGAGTAGGAAGGGGAGGAGG + Intergenic
961705047 3:128778036-128778058 GTGTCAGGAGGGAAAGAAGATGG + Intronic
961954299 3:130785436-130785458 CTCTGAGGAGGTAGGGCAGGTGG - Intergenic
962021023 3:131502211-131502233 GTGGGCGGAGGTCAGGAAGAAGG + Intronic
962263416 3:133928882-133928904 GTGTGCAAAGGTAAGGAAGCAGG - Exonic
962502422 3:136008976-136008998 GTGTGAGGAGGAAAGTGGGGTGG - Intronic
962711667 3:138091611-138091633 GTGAGAGCAAGAAAGGAAGGTGG + Intronic
962791382 3:138814620-138814642 TTGAGTGGAGGAAAGGAAGGTGG - Intronic
963120042 3:141768711-141768733 GATTGAGGAGGGAAGGAAGGTGG - Intergenic
963351518 3:144158064-144158086 GTGTGAGGAGGAAAGAAGGGAGG - Intergenic
963769824 3:149378566-149378588 ATGGGGGGAGGGAAGGAAGGAGG + Intergenic
963846958 3:150168974-150168996 GCTTGTGGGGGTAAGGAAGGAGG + Intergenic
963947384 3:151161167-151161189 GAGTGGGGAGGTAGGAAAGGAGG + Intronic
964389367 3:156181717-156181739 GTGTGGGGAGAAATGGAAGGAGG + Intronic
966377315 3:179309647-179309669 GTGTTTGGAGGTGAGGAAGAGGG - Intergenic
966936482 3:184712948-184712970 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
967277971 3:187795271-187795293 GAGGGAGGAGGTAAGGAGGAAGG + Intergenic
967503389 3:190225420-190225442 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
967538597 3:190637777-190637799 GTTTGGGGAGGTGGGGAAGGTGG - Intronic
967662136 3:192125696-192125718 GTTGGAGAGGGTAAGGAAGGGGG + Intergenic
967768772 3:193311542-193311564 GGGTGGGGAGGGAAAGAAGGAGG + Intronic
968591239 4:1460624-1460646 GAGGGAGGAGGGAAGGAAGGTGG - Intergenic
968742179 4:2336849-2336871 GAGTGAGAAGGTGAGGAGGGAGG + Intronic
968742195 4:2336927-2336949 GAGTGAGGAGGTGAGGAGTGAGG + Intronic
968948501 4:3678111-3678133 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948504 4:3678126-3678148 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948508 4:3678156-3678178 ATGTGAGAAGGTGAGGAATGAGG + Intergenic
968948516 4:3678200-3678222 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948519 4:3678215-3678237 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948526 4:3678252-3678274 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948535 4:3678304-3678326 ATGTGAGGAGGTGAGGAATGAGG + Intergenic
968948542 4:3678348-3678370 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948547 4:3678378-3678400 ATGTGAGGAGGTGAGGAACAAGG + Intergenic
968948555 4:3678422-3678444 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948578 4:3678535-3678557 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948596 4:3678635-3678657 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948601 4:3678664-3678686 GAGTGAGGAGGTGAGGACTGAGG + Intergenic
968948622 4:3678783-3678805 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
968948631 4:3678828-3678850 GAGTGAGGAGGTGAGGAGTGAGG + Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970747824 4:19320507-19320529 GTGTGAGCAGGGAAGGGAGGGGG + Intergenic
971505007 4:27357046-27357068 GTGTGAGGGGCTAAGGATGGAGG + Intergenic
972299439 4:37771195-37771217 GTGGGATGAGGAAAGGAAGAGGG - Intergenic
972388470 4:38590277-38590299 TTGAGAGGATGTAAGGAAGGAGG - Intergenic
973054776 4:45641955-45641977 GTGAAAGGAAGGAAGGAAGGAGG - Intergenic
973150205 4:46878238-46878260 GGGTGAGGAGGTAAGGAAAAGGG + Intronic
973374773 4:49279176-49279198 GTGTGAGGACGGAATGCAGGAGG + Intergenic
973376573 4:49291217-49291239 GTGTGAGGACGGAATGCAGGAGG + Intergenic
973379746 4:49311858-49311880 GTGTGAGGACGGAATGCAGGAGG - Intergenic
973382638 4:49331065-49331087 GTGTGAGGACGGAATGCAGGAGG - Intergenic
973765372 4:54157176-54157198 GGGGGAGGAAGGAAGGAAGGGGG + Intronic
974000730 4:56508223-56508245 GTGTGTCAAGGTAAGGAAGAGGG - Intronic
974142801 4:57909105-57909127 GTGTGAGAAGGAAGCGAAGGTGG - Intergenic
974877599 4:67717302-67717324 GTGGGAGTAGTTCAGGAAGGAGG + Intergenic
974890356 4:67874583-67874605 GAGTGAGGAGGTGAGAAGGGAGG + Intronic
975009800 4:69336071-69336093 CTGTGAGGAGGAAAGGAACGTGG + Intronic
975110496 4:70618012-70618034 GTGTGATGAGGTAACAAACGTGG - Intergenic
975640292 4:76493604-76493626 GCGTGAGGAAGAAAGGAGGGAGG - Intronic
976005168 4:80421061-80421083 ATATGAGGAGATAAGGAAAGAGG - Intronic
976245493 4:83002385-83002407 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
976245523 4:83002464-83002486 GAGGGAGGAGGGAAGGAGGGAGG + Intronic
976281919 4:83334508-83334530 GTGTCAGGAGGACAGGAAAGGGG + Intronic
976455756 4:85245552-85245574 TTTTGAGGAAGAAAGGAAGGGGG - Intergenic
976475617 4:85479190-85479212 GTGTGGGGTGGTATGGAAAGTGG - Intronic
977178440 4:93842840-93842862 TGGTGAGGAGGTAAGAAGGGAGG + Intergenic
977463489 4:97355773-97355795 GTGTCAGGTGGGAAGGAAGAGGG - Intronic
977593368 4:98851020-98851042 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
977763569 4:100771091-100771113 GTGGGAGGGAGGAAGGAAGGAGG + Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
977960626 4:103081061-103081083 GTGAGAAGAGGGAAGGAAAGGGG - Intronic
978029733 4:103926240-103926262 GTGTGAGGCAGGATGGAAGGAGG - Intergenic
978165644 4:105603387-105603409 GTGAGGAGAGGTAAGGGAGGGGG + Intronic
978733377 4:112057479-112057501 GTGTGATGGGGTAGGAAAGGGGG - Intergenic
978928240 4:114277308-114277330 GAGAGAGGAGGCAAAGAAGGAGG - Intergenic
979612946 4:122708364-122708386 CTGTTAGGAGGCCAGGAAGGAGG + Intergenic
980280570 4:130714281-130714303 GTGGGGGGAGGTAGGGAGGGAGG - Intergenic
980384131 4:132063759-132063781 CAGTGAGGAGGTAAGGAGGGAGG - Intergenic
980735201 4:136876355-136876377 GTCTGGGAAGGTTAGGAAGGGGG + Intergenic
980899173 4:138888030-138888052 GTGTGAGGAAGTCAGGAAGAGGG + Intergenic
980903064 4:138923414-138923436 GGGTGAGGAGGAAAGAAATGAGG + Intergenic
981092169 4:140743029-140743051 GAGGAAGGAGGAAAGGAAGGAGG + Intronic
981511076 4:145559502-145559524 GTGGGAGGAGGTAATAAAGGGGG + Intergenic
981536152 4:145801924-145801946 GGGTGGGGAGGGCAGGAAGGTGG + Intronic
981750654 4:148090255-148090277 GTGTGACGAGGGAAGGGAGGAGG + Intronic
982169082 4:152643912-152643934 GGGAGAGGAGGGAGGGAAGGAGG - Intronic
982232460 4:153221941-153221963 GAGTGAGGAAGGAAGGAAAGAGG + Intronic
982334577 4:154219921-154219943 GTGGGAGGAGGGAGGGAAGGAGG - Intergenic
982469489 4:155770724-155770746 GTATAAGGTGGTAAGGATGGAGG + Intronic
983197783 4:164826603-164826625 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
983517117 4:168669488-168669510 GGCTGAGGAGGTAAGGAGGGAGG + Intronic
983809543 4:172042710-172042732 GAGAGATGAGTTAAGGAAGGTGG - Intronic
984658972 4:182352108-182352130 GTGGGGTGGGGTAAGGAAGGAGG - Intronic
985336965 4:188906149-188906171 GAGGAAGGAGGAAAGGAAGGGGG - Intergenic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
985825712 5:2189734-2189756 GTGTGAGGTGGGAATCAAGGTGG + Intergenic
985846833 5:2356029-2356051 AGGTGAGGAGGTAAGGAAGGAGG - Intergenic
985993693 5:3584582-3584604 ATGGGAGGAAGGAAGGAAGGAGG + Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
986313330 5:6571006-6571028 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313338 5:6571025-6571047 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313382 5:6571153-6571175 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313395 5:6571188-6571210 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313419 5:6571258-6571280 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313474 5:6571425-6571447 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313487 5:6571460-6571482 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313500 5:6571495-6571517 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313524 5:6571565-6571587 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313552 5:6571644-6571666 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313565 5:6571679-6571701 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
986313578 5:6571714-6571736 GAGGGAGGAGGGAAGGAGGGTGG + Intergenic
986396357 5:7334614-7334636 GTGTGAGAAGCTAAGGTAAGAGG - Intergenic
986452977 5:7884663-7884685 GGGTGTGGAGGGTAGGAAGGGGG - Intronic
986734349 5:10657046-10657068 GTTTGAGGAGGTAGGTATGGAGG + Intergenic
986976863 5:13404947-13404969 GTTCGAAGTGGTAAGGAAGGTGG + Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
988111250 5:26823688-26823710 AAGGGAAGAGGTAAGGAAGGAGG - Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
989138501 5:38179092-38179114 GGGTGAGGAAGAAAGGAAGAAGG + Intergenic
989174999 5:38515638-38515660 GGGAGAGGAGGAAAGGGAGGGGG + Intronic
989623837 5:43410690-43410712 GTGGGAGTAGGTCAGGAAGCTGG + Intronic
989660476 5:43792098-43792120 GTGTGAGTAGGTAAACAAAGCGG + Intergenic
990496626 5:56354306-56354328 GTGGGAACAGGAAAGGAAGGAGG + Intergenic
990581934 5:57173977-57173999 GATTGAGGAGGGAGGGAAGGCGG - Intronic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
990637445 5:57745005-57745027 GTGTGTGTATGTAAGAAAGGAGG - Intergenic
990853660 5:60237976-60237998 GTGAAGGGAGGTAGGGAAGGAGG - Intronic
990981239 5:61604290-61604312 GGATGAGGAGATGAGGAAGGTGG - Intergenic
991575486 5:68099092-68099114 ATGTGCAGAGGTCAGGAAGGAGG + Intergenic
991974723 5:72174904-72174926 GGGGAAGGAGGGAAGGAAGGAGG - Intronic
992481539 5:77156803-77156825 GGGTGGGGAGGTAAGGGATGGGG + Intergenic
992873141 5:81025963-81025985 GAGGGAAGAGGGAAGGAAGGAGG - Intronic
993101184 5:83541668-83541690 GTGTCAGGAGATAAAGAGGGAGG - Exonic
993251073 5:85523946-85523968 GAATGAGGAGATAAGGAAGTTGG - Intergenic
993298449 5:86175257-86175279 GTGTTAGGAAGTGAGGTAGGAGG + Intergenic
993557696 5:89362083-89362105 GTGAGTGGAGGTAAGAAATGAGG - Intergenic
993617329 5:90129709-90129731 CCTTGAGAAGGTAAGGAAGGAGG + Intergenic
993626299 5:90228552-90228574 GTGTAAGGAGGTTAGGAAACTGG - Intergenic
993654290 5:90558732-90558754 GAGGGAGGAGGCAAGGGAGGGGG + Intronic
993775725 5:91993285-91993307 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
993969365 5:94398001-94398023 GAGGGAGGAGGGAAGGAAGGAGG - Intronic
994055355 5:95408106-95408128 GAGAGAGGAGGGAAGGAGGGAGG + Intronic
994276123 5:97840307-97840329 GTGAGAGGAGGCAAGGAAATGGG - Intergenic
995354654 5:111224194-111224216 GGGTGAGGAGGGAAGGAGCGAGG + Exonic
995410627 5:111853225-111853247 GGGTTAGGAGGTAGGGAAGCAGG + Intronic
995580395 5:113594250-113594272 ATGTGACGAGGGAAGGAGGGAGG - Exonic
996308646 5:122078254-122078276 GTGTCTGGAGTGAAGGAAGGAGG + Exonic
996544099 5:124659442-124659464 GTGGCAGGAGCAAAGGAAGGAGG + Intronic
997126666 5:131233992-131234014 GTAAGAGCAGGTAAGGAAAGAGG - Intergenic
997261372 5:132467861-132467883 GTGGGAGGAGGTCAAGAAAGAGG - Intronic
997431137 5:133842034-133842056 TTTAGAGGAGGGAAGGAAGGTGG - Intergenic
997741627 5:136260011-136260033 GTATGTGGAGGAAAGGAAGAAGG + Intronic
998066006 5:139159263-139159285 ATGTGAGGAGGTAAAGAACTGGG + Intronic
998131890 5:139655544-139655566 GTGTGGGGAGGTAGGTCAGGAGG - Intronic
998333154 5:141347023-141347045 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
998333165 5:141347083-141347105 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
998484720 5:142491573-142491595 GAGGGAGGAAGGAAGGAAGGGGG + Intergenic
998534110 5:142913400-142913422 GGGGGAGAAGGAAAGGAAGGAGG - Intronic
998820747 5:146055753-146055775 GTGTGCTGAGGGAAGGAAGGGGG - Intronic
998912017 5:146970075-146970097 GTGGGAGGATGTAAAGAGGGTGG - Intronic
999298582 5:150476101-150476123 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
999514203 5:152284642-152284664 CTGTGAGGCAGTAAGGAAGCAGG + Intergenic
999751704 5:154632332-154632354 GAGGGAGGAGGGAAGGAAGAAGG - Intergenic
999926674 5:156386233-156386255 GTGTGACAAGGTAAAGAGGGTGG + Intronic
1000723134 5:164733593-164733615 GAGTGAGAAGGCAAGGAGGGAGG + Intergenic
1000847656 5:166301458-166301480 GAGTGAGGAAGCAAGGAAGAGGG + Intergenic
1001273240 5:170331589-170331611 GTGTGGGGAGGTGGGGAAGGAGG + Intergenic
1001515452 5:172352468-172352490 ACTTGAGGAGGTAAGGCAGGAGG - Intronic
1001626993 5:173144467-173144489 GGGTGGGGAGGGAAAGAAGGTGG + Exonic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1001802887 5:174558910-174558932 GGGGAAGGAGGGAAGGAAGGAGG - Intergenic
1001919435 5:175588733-175588755 GAGGGAGGAGGGAAGGAAGTAGG + Intergenic
1001966491 5:175913548-175913570 GTGTGAGGGTATTAGGAAGGGGG - Intergenic
1002065939 5:176651657-176651679 GGGTGAGAAGGTAAGGCAGCGGG + Exonic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002193505 5:177490655-177490677 GAGGGAGGAGGGAAGGAAGGAGG + Intronic
1002250456 5:177925656-177925678 GTGTGAGGGTATTAGGAAGGGGG + Intergenic
1002255434 5:177954780-177954802 GAGGGAGGAGGGAGGGAAGGAGG + Intergenic
1002273253 5:178086613-178086635 GTGGGAGCAGGTAAAGGAGGAGG - Intergenic
1002829048 6:802242-802264 GTTTGAGGAGGTAGGGAGTGGGG + Intergenic
1003137002 6:3441491-3441513 CTGTGAGGAGCTGATGAAGGTGG - Intronic
1003388519 6:5691854-5691876 GTGTGAGTAGGTAAACAAAGCGG - Intronic
1003464865 6:6369267-6369289 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
1003712130 6:8603813-8603835 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1003991935 6:11494802-11494824 GTGTGATGAGGTAGGCAGGGAGG - Intergenic
1004357867 6:14945622-14945644 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1004411604 6:15386266-15386288 GAGAGAGGGGGAAAGGAAGGGGG - Intronic
1004538989 6:16531214-16531236 GTGAGAGGAGTTATGGAAGAGGG - Intronic
1004605312 6:17189212-17189234 GTGTGAGGAGGAAATAAAAGAGG + Intergenic
1004725619 6:18308788-18308810 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1004980907 6:21022603-21022625 GTGTGAGGAGGGAAGGGGGATGG + Intronic
1005081959 6:21965415-21965437 GGGAGAGGAGGAGAGGAAGGAGG - Intergenic
1005158086 6:22831288-22831310 GTGGAAGGAAGGAAGGAAGGAGG - Intergenic
1005572291 6:27157098-27157120 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1005852495 6:29832015-29832037 GTGGGAGGAGGGAGGGAGGGAGG + Intergenic
1005859831 6:29891677-29891699 GTGGGAGGAGGTAGGGAGGGAGG + Intergenic
1005960278 6:30688774-30688796 GGGTAAGGAGGAAAGCAAGGAGG + Exonic
1006336767 6:33425149-33425171 GTGTATGGAGGTAGGGATGGAGG + Intronic
1006369320 6:33634225-33634247 GTGTGTGTAGATAAAGAAGGTGG - Intronic
1006639878 6:35484423-35484445 GTGTGATGAGGCAAGGAGGGTGG + Intronic
1007091683 6:39188763-39188785 CTGTGGGGAGGTAAGGACGCGGG - Intergenic
1007288517 6:40765934-40765956 GTGTGTGGAGGGCAGGAAGAGGG - Intergenic
1007386371 6:41522980-41523002 GGGGGAGGCGGGAAGGAAGGAGG - Intergenic
1007556625 6:42771514-42771536 GTCTGAAGTGGTAGGGAAGGAGG + Intronic
1007614901 6:43174133-43174155 GTGAGAGGAGGGAAGGGAGTGGG + Intronic
1007709333 6:43811824-43811846 GTGTGGGGATGTGAGGATGGGGG + Intergenic
1007925047 6:45643648-45643670 GTGGGAGAAGGCGAGGAAGGAGG - Intronic
1007981721 6:46166212-46166234 GAGAGAGGAGGGAGGGAAGGAGG - Intronic
1009035444 6:58112329-58112351 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009211259 6:60865921-60865943 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009732693 6:67630476-67630498 GTGGGAGGAGGTAGTGAATGGGG - Intergenic
1010177409 6:73045144-73045166 GAGTGCAGGGGTAAGGAAGGTGG - Intronic
1010686527 6:78859937-78859959 GTGTGTGGAGGTAGGGAAGGCGG - Intergenic
1013677369 6:112480340-112480362 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1013773651 6:113654472-113654494 AAGGGAGGAGGTAAGGAAGTTGG - Intergenic
1013847897 6:114476735-114476757 GAGAGAGGAAGTAAAGAAGGAGG - Intergenic
1014294689 6:119603974-119603996 TTGGGAGGAGGTAAGGAAGAGGG + Intergenic
1014561885 6:122901015-122901037 GAGGGAGGAAGTAAAGAAGGAGG - Intergenic
1014627755 6:123750359-123750381 GTTTGAGAAAGAAAGGAAGGAGG - Intergenic
1015610003 6:135006748-135006770 GAGTGAGGAGATAAGGAAGGAGG + Intronic
1015796368 6:137016110-137016132 GGGTCAGGAGGAAAGGGAGGTGG - Intronic
1016185017 6:141188340-141188362 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1017506436 6:155072801-155072823 GAGGGAGGAGTTCAGGAAGGAGG + Intronic
1017927711 6:158924646-158924668 GAGTGAGGGGGAAGGGAAGGGGG + Intergenic
1018459533 6:163984832-163984854 GGGAGAGGAGGTTAGGCAGGTGG + Intergenic
1018627719 6:165795897-165795919 GTCTGAGGAGGTATGGAGGGTGG - Intronic
1018781923 6:167076110-167076132 GAGTAAGGAAGGAAGGAAGGAGG - Intergenic
1018964476 6:168473841-168473863 GTGTGAGGAAGGAGGGCAGGGGG + Intronic
1019196581 6:170286765-170286787 GTGTGAGGAGGTGGGGCCGGGGG - Intronic
1019346097 7:531583-531605 GAGAGAGGAGGTGAGGGAGGAGG + Intergenic
1019346521 7:533427-533449 GTGGGTGGAGGGAAGGAGGGAGG + Intergenic
1019419344 7:943403-943425 GAGTGAGGAGGAAGGGAATGAGG + Intronic
1019419409 7:943647-943669 GAGTGAGGAGGAAGGGAATGAGG + Intronic
1019446280 7:1073309-1073331 CGGTGAGGAGGTGAGGAGGGAGG - Intronic
1019453115 7:1109880-1109902 CCGTGAGGAGGTGAGGATGGAGG - Intronic
1019508351 7:1404797-1404819 GTGGGAGGAGGGGAGGGAGGAGG + Intergenic
1019508366 7:1404831-1404853 GTGGGAGGAGGGGAGGGAGGAGG + Intergenic
1019508381 7:1404865-1404887 GTGGGAGGAGGGGAGGGAGGAGG + Intergenic
1019508396 7:1404899-1404921 GTGGGAGGAGGGGAGGGAGGAGG + Intergenic
1019778812 7:2927932-2927954 TTTTTAGGAAGTAAGGAAGGTGG + Intronic
1019929944 7:4216708-4216730 GGGTGAGGAGGTGTGGAAAGAGG - Intronic
1020104139 7:5413365-5413387 GGGAGAGGAGGGAAGGAGGGAGG - Intronic
1020638684 7:10728442-10728464 GTGGGTGGAGGGAAGGGAGGTGG - Intergenic
1021112453 7:16710667-16710689 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1022009632 7:26297625-26297647 ATGTGAGGAAAGAAGGAAGGAGG - Intronic
1022094172 7:27128817-27128839 GGAAGAGGAGGTAAGGAAGGTGG + Exonic
1022154122 7:27642100-27642122 GTGTGAAGAAGGAAAGAAGGTGG - Intronic
1023138804 7:37080692-37080714 CTTTGAGAAGGTGAGGAAGGTGG - Intronic
1023180789 7:37481126-37481148 GTGAGAGGAAGGAAGGATGGAGG + Intergenic
1023505874 7:40899228-40899250 TGGTGAGGAGGGAGGGAAGGAGG - Intergenic
1023542501 7:41280748-41280770 CTATGAGGAAGTAAGGAAAGCGG - Intergenic
1023565146 7:41516684-41516706 GTGGGAGTAGGGCAGGAAGGTGG - Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023737485 7:43247890-43247912 GAGAGAGGAAGGAAGGAAGGAGG + Intronic
1023878737 7:44306924-44306946 GTGTGAGCAGGAAGAGAAGGGGG + Intronic
1023996574 7:45162341-45162363 GGGAGAGAAGGAAAGGAAGGTGG + Intronic
1024009924 7:45258894-45258916 GTGTGAGGAGGTGAGAGAAGAGG + Intergenic
1024266390 7:47610083-47610105 ATGTGTGGAGGGAAGGTAGGTGG - Intergenic
1024331201 7:48156995-48157017 GTGTCAGGAGGGAAGGCAGATGG + Intergenic
1024799686 7:53061562-53061584 ATTTGTGGAGGAAAGGAAGGAGG + Intergenic
1024969924 7:55059605-55059627 GAGTGAGCAGGTGGGGAAGGAGG - Intronic
1026040744 7:66865910-66865932 GTGAGGGGAGGGAAGGGAGGAGG - Intergenic
1026381279 7:69801989-69802011 GGGTGAGGAAGTAAGCCAGGTGG + Intronic
1026638869 7:72106842-72106864 GGAGGAGGAGGGAAGGAAGGAGG + Intronic
1026927493 7:74204325-74204347 GGGAAAGGAGGGAAGGAAGGAGG + Intronic
1026927508 7:74204366-74204388 GGGAAAGGAGGGAAGGAAGGAGG + Intronic
1026927530 7:74204439-74204461 GGGAAAGGAGGGAAGGAAGGAGG + Intronic
1026942792 7:74297366-74297388 GTGGGAGGAGCTGAGGCAGGAGG + Intronic
1027364276 7:77441206-77441228 GTAGGAGGAGGCAAAGAAGGCGG + Intergenic
1027479337 7:78675386-78675408 GTAAGAGGAGGAAAGGAAGGAGG + Intronic
1027521550 7:79215636-79215658 GTGGGAGGGGGTCAGGGAGGTGG - Intronic
1027879105 7:83810485-83810507 GAGGGAGGAGGCAAAGAAGGGGG - Intergenic
1028328817 7:89562542-89562564 GGGTAAGGAGGTAAGGAAATGGG - Intergenic
1028413753 7:90558339-90558361 GAGTGATGGGGTAGGGAAGGGGG + Intronic
1028477710 7:91268266-91268288 ATTTCAGGAGGTAAAGAAGGTGG + Exonic
1029575832 7:101402671-101402693 GTGAAAGGAGGGAGGGAAGGAGG - Intronic
1029748730 7:102531157-102531179 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1029766677 7:102630241-102630263 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1029795343 7:102888650-102888672 AGTTGAGTAGGTAAGGAAGGAGG + Intronic
1030289923 7:107861897-107861919 TGGTGAGGAGGGAAGGAAGAAGG + Intergenic
1030375737 7:108751354-108751376 GTATGAGGAGGACAGGAAGGAGG - Intergenic
1030454343 7:109754354-109754376 ATGTGAGGTGGTGAGGGAGGTGG + Intergenic
1030509910 7:110471248-110471270 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
1030693923 7:112563559-112563581 GAGGGTGGGGGTAAGGAAGGTGG - Intergenic
1031177529 7:118371714-118371736 GTGTGGGGGGCTAATGAAGGAGG - Intergenic
1031991853 7:128203560-128203582 CTGTTAGGAGGAAAGGGAGGAGG - Intergenic
1032360268 7:131248954-131248976 GTGGGAGAAGGTGAGGAAAGTGG - Intronic
1032496554 7:132367427-132367449 GAGTGAGGTGGCAGGGAAGGAGG + Intronic
1033215088 7:139487634-139487656 GGGAGAGGAGGGAAGGAAAGGGG + Intergenic
1034273851 7:149815620-149815642 GTGGGAGGAGGGATGGATGGGGG + Intergenic
1034284507 7:149875690-149875712 GGGTGAGGAGGAAAGGAGGGAGG - Intronic
1034337538 7:150333185-150333207 GGGTGAGGATGAAAGGAAGAGGG + Intronic
1034340087 7:150347231-150347253 GAGGGAGGAGGGAAGGAGGGAGG - Intergenic
1034639576 7:152591996-152592018 GTGTGAGGAGGTGGGGAGAGGGG + Intergenic
1035433797 7:158842417-158842439 GTGTGACCTGGTTAGGAAGGTGG + Intergenic
1035581980 8:746197-746219 GTGTGAGAAGGCAAGGGAGCTGG - Intergenic
1035678646 8:1471579-1471601 GTGAGAGGAGGTTAGGAGGGAGG - Intergenic
1036011418 8:4729610-4729632 CTGTGAGCAGGTGAGAAAGGGGG + Intronic
1036452213 8:8878708-8878730 GAGTGAGGAGGAAGGGAGGGAGG + Intronic
1036992796 8:13617882-13617904 TTGTGAGCAGGGAAGGAGGGAGG + Intergenic
1037561421 8:20078158-20078180 GTATCAGGAAGGAAGGAAGGAGG - Intergenic
1037855866 8:22370253-22370275 GTGTGAGCAGGTAAGGAAGGAGG - Intronic
1037867435 8:22457082-22457104 GGGGAAGGAGGGAAGGAAGGAGG - Intronic
1038012453 8:23486015-23486037 GAGGGAGGAAGGAAGGAAGGTGG - Intergenic
1038400436 8:27280319-27280341 GGGTGTGGGGGTAAGGCAGGGGG - Intergenic
1039027673 8:33275521-33275543 GTGAGAGAAGGGAAGGGAGGTGG - Intergenic
1039241967 8:35567166-35567188 GTATGAGGAGGTGAAGAAAGGGG - Intronic
1039403586 8:37293963-37293985 GTGTGTGGAGGGAAAGAAAGAGG - Intergenic
1039931982 8:42001008-42001030 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
1040866336 8:52052298-52052320 GGGTGGGGAGGGAAGGAAGGGGG - Intergenic
1041219394 8:55633789-55633811 GTGTGAGAGGGCAATGAAGGAGG - Intergenic
1042311221 8:67380979-67381001 TTCTGAGGAGGCAAGGAATGAGG + Intergenic
1042457029 8:69017464-69017486 GTGTAAGAGGGTATGGAAGGGGG - Intergenic
1042553692 8:70016290-70016312 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1042758218 8:72241777-72241799 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1042836377 8:73082343-73082365 GTGTGAGGATGATAGGAAAGCGG - Intronic
1043247175 8:78019052-78019074 GTGTGTGGAGTTGAGGAAGAAGG - Intergenic
1044473525 8:92600020-92600042 GTGGCAGAAGGTTAGGAAGGAGG + Intergenic
1044648987 8:94474889-94474911 GAGGGAGGAGGGAGGGAAGGCGG - Intronic
1045568858 8:103349349-103349371 GTGTGGGAAGGTCAAGAAGGAGG + Intergenic
1046092945 8:109524809-109524831 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1046211021 8:111076218-111076240 TTGGGAGGAGGTTAGGAAGGAGG + Intergenic
1047021085 8:120775672-120775694 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
1047324048 8:123819439-123819461 GAAAGAGGAGGGAAGGAAGGTGG - Intergenic
1047653289 8:126947861-126947883 GTGAGAGGAGGCAAGAGAGGAGG + Intergenic
1047772301 8:128039248-128039270 GTGGGAGGAGGGAGGAAAGGGGG - Intergenic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1048402298 8:134083340-134083362 GGCAGAGGAGGTAGGGAAGGAGG - Intergenic
1048618241 8:136103183-136103205 GTGAGAGGGTGTGAGGAAGGTGG - Intergenic
1048736993 8:137513054-137513076 GAGAAAGGAGGGAAGGAAGGAGG - Intergenic
1049370289 8:142261121-142261143 GAGAGAGGAGGGAGGGAAGGAGG + Intronic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1050050887 9:1600329-1600351 GAATGAGGAGGTAGGGAAAGAGG - Intergenic
1050881519 9:10705817-10705839 GTTTGAGGAGGAAATGTAGGAGG - Intergenic
1051221404 9:14852105-14852127 ATGACAGGAGGTGAGGAAGGCGG - Intronic
1051349311 9:16184134-16184156 AGGTGAGGAGGGGAGGAAGGAGG + Intergenic
1051984798 9:23070966-23070988 ATTTGGGGAGGTAAGGCAGGCGG + Intergenic
1052145695 9:25045622-25045644 GTGTGAGTAGGTAAACAAAGTGG - Intergenic
1052174634 9:25443598-25443620 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1052174645 9:25443630-25443652 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1052321338 9:27170682-27170704 GTGTGGGGAGGTAAGGGAGTGGG + Intronic
1053000711 9:34575921-34575943 CTGTGAGGAGGGGAGGAAAGGGG - Intronic
1053009917 9:34627292-34627314 GTGTGAGAAGGTAGGCAGGGTGG + Intronic
1053516520 9:38735046-38735068 GGGAGAGGAAGGAAGGAAGGAGG - Intergenic
1054460119 9:65458211-65458233 GTGTGAGGCGGACAGGAGGGGGG - Intergenic
1054907141 9:70421176-70421198 GAGTCAGGAGGAGAGGAAGGGGG - Intergenic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1055091021 9:72364918-72364940 GTGGGAGGAGGGAAGCGAGGGGG + Intronic
1055843616 9:80534564-80534586 GAGTGAGGAGACAAGAAAGGAGG + Intergenic
1055856426 9:80693136-80693158 GAAGGAGGAGGAAAGGAAGGAGG - Intergenic
1056107641 9:83362883-83362905 GAGGAAGGAGGGAAGGAAGGAGG - Intronic
1056182849 9:84102389-84102411 CAGTGAGGAGGGAAAGAAGGAGG + Intergenic
1057011058 9:91601628-91601650 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1057013781 9:91632388-91632410 TTGAGAGCAGGTAAGGAAGATGG + Intronic
1057485058 9:95476295-95476317 GTGTTAGGGGGTAAGGCAGGTGG - Intronic
1057568320 9:96184431-96184453 GTGGAAGGAGGGTAGGAAGGTGG + Intergenic
1057901859 9:98955341-98955363 GTGGGAGCAGGGAAGTAAGGAGG - Intronic
1057961094 9:99457825-99457847 GAGGGAGAAGGGAAGGAAGGAGG + Intergenic
1058163520 9:101595104-101595126 GAGAGAGGAGGGAAAGAAGGAGG + Intronic
1058186558 9:101862201-101862223 GAGTGTGGAGGTGAGAAAGGAGG - Intergenic
1058502961 9:105640305-105640327 GTTTGAGAAGCTAAGGCAGGTGG + Exonic
1058674381 9:107388063-107388085 GTGTGAGGGACTGAGGAAGGAGG - Intergenic
1058794321 9:108483408-108483430 CCGTGAGGAGTTAATGAAGGTGG + Intergenic
1058794329 9:108483457-108483479 CTGTGAGGAGTTAATGAAGGTGG + Intergenic
1059366301 9:113789134-113789156 GTGGGAGGAGGTAGTGAGGGAGG - Intergenic
1059631337 9:116126227-116126249 GATAGAGGAGGGAAGGAAGGGGG - Intergenic
1059709327 9:116853173-116853195 GGGTGAGTAGTTAAGAAAGGGGG + Intronic
1059992159 9:119875527-119875549 GTCTCAGGAGGAAAGAAAGGTGG + Intergenic
1060122374 9:121005453-121005475 GAGTTAGGAGGACAGGAAGGAGG + Intronic
1060224157 9:121781247-121781269 GGATGTGGAGGTGAGGAAGGAGG + Intronic
1060688234 9:125631813-125631835 ATGGGAGGAGGTTAGGCAGGAGG - Intronic
1060830899 9:126715585-126715607 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1060858235 9:126933103-126933125 GTGAGAGGACAAAAGGAAGGCGG + Intronic
1060949061 9:127589308-127589330 GAGGGAGGAGGGAAGGAGGGAGG + Intergenic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061227075 9:129286707-129286729 TTGGGAGGAGGTAAGCCAGGTGG - Intergenic
1061294100 9:129667609-129667631 GGGTGAGGAGGGAAGGAAGGGGG + Intronic
1061389006 9:130306976-130306998 GAGGGAGGAGGGAGGGAAGGAGG - Intronic
1061865738 9:133490998-133491020 GGGGGAGGAGGAAAGGGAGGAGG + Intergenic
1062050612 9:134444671-134444693 TAGGGAGGAGGGAAGGAAGGAGG - Intergenic
1062144068 9:134979123-134979145 GAGGGGGGAGGGAAGGAAGGAGG + Intergenic
1062191119 9:135248380-135248402 GTGGGAGGAGCTAAGACAGGAGG + Intergenic
1062328251 9:136023072-136023094 GAGGGAGGAGGGAGGGAAGGAGG + Intronic
1062338725 9:136084056-136084078 GAGCGGGGAGGTAGGGAAGGTGG + Intronic
1062480915 9:136750964-136750986 GAGGGAGGAGGGGAGGAAGGAGG + Intergenic
1203698477 Un_GL000214v1:117281-117303 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203699395 Un_GL000214v1:123432-123454 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203700339 Un_GL000214v1:129715-129737 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203701261 Un_GL000214v1:135735-135757 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203480088 Un_GL000224v1:4318-4340 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203481058 Un_GL000224v1:10646-10668 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203482021 Un_GL000224v1:16955-16977 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203416727 Un_KI270330v1:289-311 GTGTGAGGACGGAATGCAGGAGG - Intergenic
1203549832 Un_KI270743v1:157730-157752 GTGTGAGGACGGAATGCAGGAGG - Intergenic
1203550771 Un_KI270743v1:163895-163917 GTGTGAGGACGGAATGCAGGAGG - Intergenic
1203568049 Un_KI270744v1:108426-108448 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1203569686 Un_KI270744v1:119669-119691 GTGTGAGGACGGAATGCAGGAGG + Intergenic
1185786783 X:2897720-2897742 ATTTGAGGAGGTAGGGGAGGCGG + Intergenic
1186065024 X:5754060-5754082 GAGGAAGGAGGGAAGGAAGGAGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186367390 X:8909871-8909893 ATGGGAGGAGGGAAGGAAGCTGG + Intergenic
1186502997 X:10066799-10066821 GTGGGAGGAGACAAGGAAGTCGG + Intronic
1188163229 X:26828237-26828259 ATGAGAGGAAGAAAGGAAGGAGG - Intergenic
1188361251 X:29256996-29257018 GTGAGAGGAGGTAAGAAAACAGG - Intronic
1189078013 X:37938651-37938673 GGCTGAAGAGGGAAGGAAGGAGG - Intronic
1190739471 X:53279892-53279914 GAGAGAGGAAGGAAGGAAGGAGG + Intronic
1191110489 X:56799984-56800006 GTGTGAGGGGGTAAAGGGGGAGG + Intergenic
1191780916 X:64864123-64864145 ATGGGTGGAGGAAAGGAAGGTGG - Intergenic
1193369136 X:80672376-80672398 AGGTGAGGAAGGAAGGAAGGAGG + Exonic
1194647915 X:96481203-96481225 GTGGGATGAGGTGAGGATGGGGG + Intergenic
1194751621 X:97691542-97691564 GTTGGAGGAGGTAATAAAGGAGG - Intergenic
1194844822 X:98792105-98792127 GAGGGAGGAGGTAAGGCAGGGGG + Intergenic
1195071114 X:101280965-101280987 GTGTGAGGTGGAAGGGAAGTGGG + Intronic
1195385867 X:104313239-104313261 GGCTGGGGAGGAAAGGAAGGAGG - Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195658089 X:107352398-107352420 GATAGAGGAGGTAAGAAAGGAGG - Intergenic
1195658801 X:107358728-107358750 GAGTGAGGAAGGAAGGAAGAAGG + Intergenic
1196143532 X:112291924-112291946 AAGGGAGGAGGGAAGGAAGGGGG - Intergenic
1196301138 X:114050910-114050932 TTCTGAGGAGGTAAGAACGGAGG + Intergenic
1196874059 X:120141257-120141279 ATGGGGGGAGGTAGGGAAGGGGG - Intergenic
1197207361 X:123801562-123801584 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
1197207407 X:123801680-123801702 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
1197701388 X:129602798-129602820 GTGAGTGGAGGTAAGAAAGTGGG - Intergenic
1197757380 X:130005316-130005338 AGGTGAGGAGGCCAGGAAGGTGG + Exonic
1197904881 X:131413998-131414020 GTGGGAGGAGGAAAAGAAGCAGG + Intergenic
1198273135 X:135074675-135074697 TTCTGAGGAGGAAAAGAAGGAGG - Intergenic
1198388239 X:136148003-136148025 GAGTGAGGAGGGAGTGAAGGGGG + Intronic
1198683344 X:139204280-139204302 GAGTGGGGAGGAAAGGAAAGGGG + Intronic
1199934663 X:152560752-152560774 ATGTGAGGAAGCAAGGTAGGAGG + Intergenic
1200097909 X:153672715-153672737 GTGGGAGGTGGGAAGGAAGTGGG + Intronic
1201428235 Y:13878014-13878036 GTGTGAGCAGGTTAGTTAGGAGG + Intergenic
1201451171 Y:14116269-14116291 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1201550072 Y:15210251-15210273 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1202103379 Y:21334652-21334674 CTATGAGGAGGCAAGGAGGGAGG - Intergenic