ID: 990591616

View in Genome Browser
Species Human (GRCh38)
Location 5:57271176-57271198
Sequence CTGGTGACACAGCAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990591606_990591616 24 Left 990591606 5:57271129-57271151 CCTTTTGGAGTTCAGTATAGGTG No data
Right 990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990591616 Original CRISPR CTGGTGACACAGCAGGAGCC AGG Intergenic
No off target data available for this crispr