ID: 990592947

View in Genome Browser
Species Human (GRCh38)
Location 5:57283944-57283966
Sequence CCTTATCTTTGGAAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990592932_990592947 18 Left 990592932 5:57283903-57283925 CCCTTTGGGCCAGTGTTGGTGGT No data
Right 990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG No data
990592933_990592947 17 Left 990592933 5:57283904-57283926 CCTTTGGGCCAGTGTTGGTGGTA No data
Right 990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG No data
990592929_990592947 30 Left 990592929 5:57283891-57283913 CCTGGCAGTACTCCCTTTGGGCC No data
Right 990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG No data
990592934_990592947 9 Left 990592934 5:57283912-57283934 CCAGTGTTGGTGGTAATCATTGG No data
Right 990592947 5:57283944-57283966 CCTTATCTTTGGAAAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990592947 Original CRISPR CCTTATCTTTGGAAAGGGGA GGG Intergenic
No off target data available for this crispr