ID: 990594011

View in Genome Browser
Species Human (GRCh38)
Location 5:57294977-57294999
Sequence TGGTGGGAATATGCATCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990594006_990594011 22 Left 990594006 5:57294932-57294954 CCAAAGCTGGTGAGTGGGTGGTA No data
Right 990594011 5:57294977-57294999 TGGTGGGAATATGCATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990594011 Original CRISPR TGGTGGGAATATGCATCTTT TGG Intergenic
No off target data available for this crispr