ID: 990594625

View in Genome Browser
Species Human (GRCh38)
Location 5:57300463-57300485
Sequence GTGGCCACCCAGACTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990594625_990594630 25 Left 990594625 5:57300463-57300485 CCACTCTCAGTCTGGGTGGCCAC No data
Right 990594630 5:57300511-57300533 AGATTAAAGCAGGAAGAATGTGG No data
990594625_990594629 15 Left 990594625 5:57300463-57300485 CCACTCTCAGTCTGGGTGGCCAC No data
Right 990594629 5:57300501-57300523 CAGCGTGGCTAGATTAAAGCAGG No data
990594625_990594627 0 Left 990594625 5:57300463-57300485 CCACTCTCAGTCTGGGTGGCCAC No data
Right 990594627 5:57300486-57300508 AATCTAATCAGCTGCCAGCGTGG No data
990594625_990594631 29 Left 990594625 5:57300463-57300485 CCACTCTCAGTCTGGGTGGCCAC No data
Right 990594631 5:57300515-57300537 TAAAGCAGGAAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990594625 Original CRISPR GTGGCCACCCAGACTGAGAG TGG (reversed) Intergenic
No off target data available for this crispr