ID: 990596261

View in Genome Browser
Species Human (GRCh38)
Location 5:57315227-57315249
Sequence TGAGTAGAGGGCAGCCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990596261_990596266 2 Left 990596261 5:57315227-57315249 CCCAGGGGGCTGCCCTCTACTCA No data
Right 990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG No data
990596261_990596273 22 Left 990596261 5:57315227-57315249 CCCAGGGGGCTGCCCTCTACTCA No data
Right 990596273 5:57315272-57315294 AGGCTTTTAGAGTTTGCTGGGGG No data
990596261_990596265 -9 Left 990596261 5:57315227-57315249 CCCAGGGGGCTGCCCTCTACTCA No data
Right 990596265 5:57315241-57315263 CTCTACTCATTTCCTCAGCATGG No data
990596261_990596270 19 Left 990596261 5:57315227-57315249 CCCAGGGGGCTGCCCTCTACTCA No data
Right 990596270 5:57315269-57315291 GTGAGGCTTTTAGAGTTTGCTGG No data
990596261_990596272 21 Left 990596261 5:57315227-57315249 CCCAGGGGGCTGCCCTCTACTCA No data
Right 990596272 5:57315271-57315293 GAGGCTTTTAGAGTTTGCTGGGG No data
990596261_990596271 20 Left 990596261 5:57315227-57315249 CCCAGGGGGCTGCCCTCTACTCA No data
Right 990596271 5:57315270-57315292 TGAGGCTTTTAGAGTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990596261 Original CRISPR TGAGTAGAGGGCAGCCCCCT GGG (reversed) Intergenic
No off target data available for this crispr