ID: 990596262

View in Genome Browser
Species Human (GRCh38)
Location 5:57315228-57315250
Sequence ATGAGTAGAGGGCAGCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990596262_990596272 20 Left 990596262 5:57315228-57315250 CCAGGGGGCTGCCCTCTACTCAT No data
Right 990596272 5:57315271-57315293 GAGGCTTTTAGAGTTTGCTGGGG No data
990596262_990596270 18 Left 990596262 5:57315228-57315250 CCAGGGGGCTGCCCTCTACTCAT No data
Right 990596270 5:57315269-57315291 GTGAGGCTTTTAGAGTTTGCTGG No data
990596262_990596271 19 Left 990596262 5:57315228-57315250 CCAGGGGGCTGCCCTCTACTCAT No data
Right 990596271 5:57315270-57315292 TGAGGCTTTTAGAGTTTGCTGGG No data
990596262_990596273 21 Left 990596262 5:57315228-57315250 CCAGGGGGCTGCCCTCTACTCAT No data
Right 990596273 5:57315272-57315294 AGGCTTTTAGAGTTTGCTGGGGG No data
990596262_990596265 -10 Left 990596262 5:57315228-57315250 CCAGGGGGCTGCCCTCTACTCAT No data
Right 990596265 5:57315241-57315263 CTCTACTCATTTCCTCAGCATGG No data
990596262_990596266 1 Left 990596262 5:57315228-57315250 CCAGGGGGCTGCCCTCTACTCAT No data
Right 990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990596262 Original CRISPR ATGAGTAGAGGGCAGCCCCC TGG (reversed) Intergenic
No off target data available for this crispr