ID: 990596263

View in Genome Browser
Species Human (GRCh38)
Location 5:57315239-57315261
Sequence ATGCTGAGGAAATGAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990596263_990596270 7 Left 990596263 5:57315239-57315261 CCCTCTACTCATTTCCTCAGCAT No data
Right 990596270 5:57315269-57315291 GTGAGGCTTTTAGAGTTTGCTGG No data
990596263_990596271 8 Left 990596263 5:57315239-57315261 CCCTCTACTCATTTCCTCAGCAT No data
Right 990596271 5:57315270-57315292 TGAGGCTTTTAGAGTTTGCTGGG No data
990596263_990596266 -10 Left 990596263 5:57315239-57315261 CCCTCTACTCATTTCCTCAGCAT No data
Right 990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG No data
990596263_990596272 9 Left 990596263 5:57315239-57315261 CCCTCTACTCATTTCCTCAGCAT No data
Right 990596272 5:57315271-57315293 GAGGCTTTTAGAGTTTGCTGGGG No data
990596263_990596273 10 Left 990596263 5:57315239-57315261 CCCTCTACTCATTTCCTCAGCAT No data
Right 990596273 5:57315272-57315294 AGGCTTTTAGAGTTTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990596263 Original CRISPR ATGCTGAGGAAATGAGTAGA GGG (reversed) Intergenic
No off target data available for this crispr