ID: 990596266

View in Genome Browser
Species Human (GRCh38)
Location 5:57315252-57315274
Sequence TCCTCAGCATGGCCTCCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990596263_990596266 -10 Left 990596263 5:57315239-57315261 CCCTCTACTCATTTCCTCAGCAT No data
Right 990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG No data
990596261_990596266 2 Left 990596261 5:57315227-57315249 CCCAGGGGGCTGCCCTCTACTCA No data
Right 990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG No data
990596262_990596266 1 Left 990596262 5:57315228-57315250 CCAGGGGGCTGCCCTCTACTCAT No data
Right 990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990596266 Original CRISPR TCCTCAGCATGGCCTCCGTG AGG Intergenic
No off target data available for this crispr