ID: 990597235

View in Genome Browser
Species Human (GRCh38)
Location 5:57323924-57323946
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990597235_990597241 24 Left 990597235 5:57323924-57323946 CCTTCTAACCTCCAGAACTCCAG No data
Right 990597241 5:57323971-57323993 TGTTTTAATCCACCACTTTGTGG No data
990597235_990597238 -8 Left 990597235 5:57323924-57323946 CCTTCTAACCTCCAGAACTCCAG No data
Right 990597238 5:57323939-57323961 AACTCCAGAACTGTGAAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990597235 Original CRISPR CTGGAGTTCTGGAGGTTAGA AGG (reversed) Intergenic
No off target data available for this crispr