ID: 990599421

View in Genome Browser
Species Human (GRCh38)
Location 5:57342527-57342549
Sequence AACTGTGTGCTTCAACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990599421_990599426 20 Left 990599421 5:57342527-57342549 CCTGTGTGTTGAAGCACACAGTT No data
Right 990599426 5:57342570-57342592 CATTGGAAAAAATTCATATGTGG No data
990599421_990599427 27 Left 990599421 5:57342527-57342549 CCTGTGTGTTGAAGCACACAGTT No data
Right 990599427 5:57342577-57342599 AAAAATTCATATGTGGCAGATGG No data
990599421_990599428 28 Left 990599421 5:57342527-57342549 CCTGTGTGTTGAAGCACACAGTT No data
Right 990599428 5:57342578-57342600 AAAATTCATATGTGGCAGATGGG No data
990599421_990599429 29 Left 990599421 5:57342527-57342549 CCTGTGTGTTGAAGCACACAGTT No data
Right 990599429 5:57342579-57342601 AAATTCATATGTGGCAGATGGGG No data
990599421_990599422 3 Left 990599421 5:57342527-57342549 CCTGTGTGTTGAAGCACACAGTT No data
Right 990599422 5:57342553-57342575 ACCCTTATGTGCTGCCGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990599421 Original CRISPR AACTGTGTGCTTCAACACAC AGG (reversed) Intergenic
No off target data available for this crispr