ID: 990604335

View in Genome Browser
Species Human (GRCh38)
Location 5:57393950-57393972
Sequence CTCTGCTGATACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990604334_990604335 -8 Left 990604334 5:57393935-57393957 CCGGAGGGAGCATGGCTCTGCTG No data
Right 990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG No data
990604329_990604335 7 Left 990604329 5:57393920-57393942 CCTACCCTAGAATTTCCGGAGGG No data
Right 990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG No data
990604332_990604335 2 Left 990604332 5:57393925-57393947 CCTAGAATTTCCGGAGGGAGCAT No data
Right 990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG No data
990604331_990604335 3 Left 990604331 5:57393924-57393946 CCCTAGAATTTCCGGAGGGAGCA No data
Right 990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990604335 Original CRISPR CTCTGCTGATACCTTGATTT TGG Intergenic
No off target data available for this crispr