ID: 990607403

View in Genome Browser
Species Human (GRCh38)
Location 5:57424066-57424088
Sequence GATGCAGTAATGCATCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990607403_990607409 15 Left 990607403 5:57424066-57424088 CCCTCAAGATGCATTACTGCATC 0: 1
1: 0
2: 1
3: 13
4: 138
Right 990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990607403 Original CRISPR GATGCAGTAATGCATCTTGA GGG (reversed) Intergenic
901646361 1:10718836-10718858 GAGGCAGTAATTCCTCTTGTGGG - Intronic
906582513 1:46947883-46947905 CTTGTAGGAATGCATCTTGATGG + Intergenic
906583279 1:46954063-46954085 CTTGTAGGAATGCATCTTGATGG + Intergenic
906601101 1:47129985-47130007 CTTGTAGGAATGCATCTTGATGG - Intergenic
907141069 1:52185621-52185643 GATGCAGAAAAGGCTCTTGATGG + Intronic
908924283 1:69235029-69235051 GATGCAGTAATGGATATTCAGGG - Intergenic
911165565 1:94721427-94721449 GATGAAGTAATGCAACCAGAGGG + Intergenic
911736714 1:101344318-101344340 GATGCTCTAATCCATCTTGCTGG + Intergenic
912565118 1:110582065-110582087 GATGACCTAATGCATCTTAATGG + Intergenic
918737279 1:188080902-188080924 TATGCAGGAATGCATATTTAAGG - Intergenic
918774069 1:188606864-188606886 AATGCAGTTATGCATTGTGATGG + Intergenic
923061508 1:230479293-230479315 CATGCAGCAATGCATTTTAAAGG + Intergenic
1063486348 10:6424263-6424285 GTTACAGAAATGAATCTTGAGGG - Intergenic
1065982878 10:30919465-30919487 GATGCAGAAGTGCATCTTAAAGG - Intronic
1066311483 10:34201185-34201207 GATGCAGTCATGTACCTTGGGGG + Intronic
1066346981 10:34597229-34597251 GGTGCAGTTATGCTTCTTGTAGG - Intronic
1066542851 10:36467799-36467821 GAGGCAGGAATGGATGTTGATGG + Intergenic
1071017522 10:81015568-81015590 GATGGAGTAATAAATTTTGATGG + Intergenic
1072241767 10:93502603-93502625 GATTCAGTATTGAATCTAGAAGG - Intronic
1073886113 10:108041529-108041551 GAGGCAGTAGTGGATTTTGATGG + Intergenic
1075818744 10:125287061-125287083 GAACCAGTAAAGGATCTTGAGGG - Intergenic
1076294347 10:129373014-129373036 GATGCAGTGAGGCATCATGGTGG + Intergenic
1076947357 10:133660313-133660335 GATGCAGTAATGCTGCCTGCTGG + Intergenic
1078621225 11:12910170-12910192 GATTCAGTCATGCATCCCGAAGG + Intronic
1082218024 11:49598327-49598349 TATGCATGAATGCATCTTTATGG + Intergenic
1087109819 11:94452400-94452422 GATACAGTAATACATCACGATGG + Intronic
1087984961 11:104666776-104666798 GGAACAGTCATGCATCTTGAGGG + Intergenic
1093256055 12:16869493-16869515 AATGTAGAAATTCATCTTGATGG - Intergenic
1093917466 12:24821646-24821668 TATGCAGTAATGTTTCTTGAAGG - Intronic
1094593408 12:31842259-31842281 GATGCAATTATGAATATTGATGG + Intergenic
1095431310 12:42137842-42137864 AAAGCAGTAATGCAACTTCAAGG + Intronic
1097143453 12:56923391-56923413 AATGAAGTTATGCATATTGAGGG + Exonic
1099431590 12:82592452-82592474 GATGCAGTGTTGCAGCTGGATGG - Intergenic
1100062466 12:90597863-90597885 TAAGCAGTAATGCTTCCTGAGGG + Intergenic
1101742767 12:107513789-107513811 GAGGCAGCAATGCACCCTGATGG + Intronic
1105796179 13:23855736-23855758 GATGCAGAAATGCATCAGAAGGG - Intronic
1108931252 13:55824728-55824750 TATGCATTAATGCATCTTTATGG - Intergenic
1109050463 13:57474323-57474345 GGTGGAGCAATGCATCTTGTAGG - Intergenic
1110096139 13:71523627-71523649 GAGACAGTAATGCATCTTGTAGG - Intronic
1110498431 13:76197131-76197153 TATGCAGGCATGCATCTTTATGG - Intergenic
1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG + Intergenic
1114355858 14:21907391-21907413 GATGGAGTTCTGTATCTTGAAGG + Intergenic
1114725580 14:24932703-24932725 GAATCAGAAATGCATTTTGAAGG + Intronic
1116555550 14:46300355-46300377 GATGCATTTATGCATATTTATGG - Intergenic
1202921410 14_KI270723v1_random:32864-32886 GATGCAGTAATGCTGCCTGCTGG + Intergenic
1202923500 14_KI270724v1_random:4716-4738 GATGCAGTAATGCTGCCTGCTGG - Intergenic
1127524541 15:59779332-59779354 GGTGCATTAGTGCTTCTTGATGG + Intergenic
1128552717 15:68608679-68608701 GATGCAGGAATGCTTGTTCATGG - Intronic
1132890292 16:2200363-2200385 GATGCAGAATTGCATGTGGAGGG - Intergenic
1134628427 16:15739512-15739534 GATGCAGGTATGCATGGTGAAGG - Intronic
1135167963 16:20157143-20157165 GATGCAGCAATGCATTTAAAGGG - Intergenic
1138049988 16:53766405-53766427 AATGCAGTGAGGCATCTTCACGG - Intronic
1138763318 16:59570019-59570041 GATTCAGTGATGTTTCTTGAGGG + Intergenic
1139475153 16:67199358-67199380 GATGGCGTCACGCATCTTGATGG - Exonic
1143576459 17:7796609-7796631 GAAGAGGTAATGCATCTTGGTGG - Exonic
1144263031 17:13541882-13541904 CATGTAGTAAAGCATGTTGAAGG + Intronic
1149096573 17:52848239-52848261 GAAACAGTAAAGCATCTTGTGGG - Intergenic
1149938771 17:60839730-60839752 GATTCAGTAACACATGTTGAAGG + Intronic
1153768551 18:8397423-8397445 TTTGCAGAAATACATCTTGAGGG - Intronic
1155122828 18:22840843-22840865 GATGCAGTGCTGCATCCAGAGGG - Intronic
1156621062 18:38852526-38852548 GATGCAGAAATATATCTTCAGGG + Intergenic
1157475823 18:48022815-48022837 AGGGCAGTAAAGCATCTTGAAGG - Intergenic
1159289640 18:66399170-66399192 GATGCTATAATTCATCTTGAGGG + Intergenic
1164173435 19:22747477-22747499 TTTGTAGGAATGCATCTTGATGG + Intergenic
1165164809 19:33844747-33844769 GAAGAAATAATTCATCTTGAAGG + Intergenic
1167821207 19:51929247-51929269 GGTGCAGTTTTGCCTCTTGATGG - Intronic
925532067 2:4875077-4875099 TATGCAGAAATGCATCCTGTTGG + Intergenic
925598283 2:5580385-5580407 GATCCAGTAATTCATCTTCTGGG + Intergenic
925945537 2:8859360-8859382 GAAGCAATATTGCTTCTTGATGG + Intronic
928676919 2:33659587-33659609 TTTGTAGGAATGCATCTTGATGG + Intergenic
929595803 2:43174957-43174979 CATGCTGGAATGCATTTTGAGGG - Intergenic
931705289 2:64941996-64942018 GATGCAGTGAGGGATCCTGAAGG - Intergenic
932007054 2:67937704-67937726 GATGCAGGAAACCATGTTGAGGG + Intergenic
937160674 2:119758745-119758767 GAGGCAGGAATGCATATTTAGGG + Intergenic
941781372 2:169449310-169449332 GATGCGGAAAGGCATCATGATGG - Intergenic
946660704 2:221996530-221996552 GATGCAGGCATACATCTAGAAGG + Intergenic
948365474 2:237451905-237451927 AATGCAGAGATGCATCTTTAGGG - Intergenic
948970266 2:241420268-241420290 CATGTAATGATGCATCTTGAAGG - Intronic
1173340761 20:42150726-42150748 GAGTCAGTAATACATCCTGAAGG + Intronic
1174066366 20:47868581-47868603 GCTGCAGTCATGAATCCTGACGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1177932876 21:27306388-27306410 GAGGCAGTAATGGTTTTTGATGG - Intergenic
1179239169 21:39573763-39573785 GATGCAGCAATGCATCTTAATGG - Intronic
949877557 3:8636093-8636115 AATGCAATAATGCATATTCACGG - Intronic
952054373 3:29426746-29426768 GTTGGAGTAATTCACCTTGAAGG - Intronic
952057708 3:29469135-29469157 AATGCATTAATGAAACTTGATGG - Intronic
957080097 3:75630103-75630125 GATGCAGTAATGCTGCCTGCTGG - Intergenic
957498869 3:81027527-81027549 ACTGCAGTAATGCACCTTGTGGG - Intergenic
959993025 3:112649503-112649525 GATGCTGAAATGTAACTTGAGGG - Intronic
962282586 3:134063454-134063476 GATGCAGGAATGCAGGTTGCTGG - Intergenic
967140600 3:186555436-186555458 GATAAAGTAAAGCATCTTGGAGG - Intronic
967913343 3:194559810-194559832 GATGTAGTAATGCCACTTAAAGG + Intergenic
970511608 4:16787245-16787267 GAGGCAGGATTGCATCTTGATGG - Intronic
971533273 4:27715902-27715924 GAAGCAGGAACTCATCTTGAGGG - Intergenic
975165303 4:71171907-71171929 GAAGCAGTAATGAAATTTGAGGG + Intergenic
975822353 4:78284935-78284957 GTTGCAGTAAATGATCTTGAAGG - Intronic
977457438 4:97279354-97279376 CATGCAGTAATGCAACATGAGGG - Intronic
981600691 4:146485301-146485323 GCTGCAGTGATTCATTTTGAGGG + Intronic
982492480 4:156046354-156046376 TGTGCAGAAATGCATCCTGAGGG + Intergenic
985450814 4:190061113-190061135 GATGCAGTAATGCTGCCTGCTGG + Intergenic
987377915 5:17253901-17253923 GATACAGTAATTAATGTTGAAGG - Intronic
987384163 5:17313400-17313422 GTTCCAGTAATGAATCTAGAAGG - Intergenic
988905601 5:35785268-35785290 AATGCAGTAGTGGATCTAGAAGG + Intronic
990607403 5:57424066-57424088 GATGCAGTAATGCATCTTGAGGG - Intergenic
990889918 5:60636789-60636811 AATGCACTAATGCATATGGATGG - Intronic
993841894 5:92890297-92890319 GATGCAGTGATGATGCTTGATGG - Intergenic
996617991 5:125464449-125464471 GATGAAGTAATGCATCTGGGGGG + Intergenic
996773945 5:127114802-127114824 TATGCATTAATGCATATTAATGG - Intergenic
999551247 5:152689536-152689558 CATGCAGTATTGCATTTGGAAGG - Intergenic
1001921546 5:175604048-175604070 GAAGCAGAATTCCATCTTGAAGG - Intergenic
1003806229 6:9728450-9728472 GATGCAGCAAGTCAGCTTGACGG - Intronic
1003894440 6:10593653-10593675 AATGAAGTATTGCATTTTGATGG + Intronic
1005019734 6:21406289-21406311 CATGCAGAAACGCATCTTGTCGG + Intergenic
1005465148 6:26105406-26105428 GGTGCAGGAAGCCATCTTGAGGG + Intergenic
1011598636 6:89039957-89039979 GATGCAGTAATGCAGGCAGAAGG - Intergenic
1012589206 6:100959122-100959144 GATTCAGTAATGTTTGTTGATGG + Intergenic
1013585227 6:111572369-111572391 GACGCAGTGATGCTTCTGGATGG - Intronic
1014602638 6:123433516-123433538 CATGCATGCATGCATCTTGAAGG - Intronic
1016119422 6:140328618-140328640 GAGGCAGTAATACATTGTGAAGG - Intergenic
1017749245 6:157474428-157474450 GATCCAGCAATGCATCTTCTGGG - Intronic
1020671515 7:11121328-11121350 AATGCTGTAAGGCATATTGATGG - Intronic
1024968621 7:55048440-55048462 GATGCAGGTATGCATCTCTAAGG - Intronic
1027020885 7:74813416-74813438 GATGAAGGAAGGCATCGTGAAGG + Intronic
1027067140 7:75132510-75132532 GATGAAGGAAGGCATCGTGAAGG - Intronic
1028828132 7:95297850-95297872 GAAGAAGTAATTCATCATGAAGG + Exonic
1030744220 7:113145684-113145706 GAAGCAGTCATTCATCTTCATGG - Intergenic
1031603355 7:123740655-123740677 GATGCAGTAAGCCATGATGAGGG - Intronic
1038769835 8:30467156-30467178 GTTGCAGTAATCCATTTTCATGG + Intronic
1039393373 8:37201342-37201364 GAGGCAATATTGCATCTTTAGGG - Intergenic
1039733132 8:40301254-40301276 TATACAGTAATGCTTCTTAAGGG - Intergenic
1039930986 8:41988893-41988915 AATGAATGAATGCATCTTGAGGG - Intronic
1041949183 8:63481150-63481172 GAGACAGTAATGGATCTTTATGG + Intergenic
1042862117 8:73325433-73325455 GATGAAGAAATGCAACTTGTAGG - Intergenic
1043677984 8:82984737-82984759 TATGAAGAAATTCATCTTGATGG + Intergenic
1044067702 8:87719240-87719262 GATGCAGTGATTCATTTTGTTGG - Intergenic
1045269429 8:100649494-100649516 GATACAGAAATGCATCTTCATGG + Exonic
1047425376 8:124740683-124740705 GGTCCAGTAATGCATCTAGATGG - Intergenic
1052041083 9:23739822-23739844 GAAGCTGTACTGCCTCTTGATGG - Intronic
1053300530 9:36946085-36946107 GATGGAGCACTGCATCCTGACGG - Intronic
1053300543 9:36946181-36946203 GATGGAGCACTGCATCCTGACGG - Intronic
1056080059 9:83083054-83083076 GATGCAGAAATGGATCTGAATGG - Intergenic
1059140708 9:111850573-111850595 GATGCAGCAATTCTTCTTTAAGG + Intergenic
1060378865 9:123145484-123145506 GATGCAGTGATACATTTTGTGGG - Intronic
1203611179 Un_KI270749v1:6328-6350 GAGGCATTCATGCAGCTTGATGG + Intergenic
1187078600 X:15962176-15962198 TATTCAGAAATGCATGTTGATGG + Intergenic
1187617085 X:21007821-21007843 GATGCAAAATTCCATCTTGAAGG - Intergenic
1187663911 X:21582485-21582507 GAGGCAGTAATGCATGTAGTAGG + Intronic
1188422631 X:30008479-30008501 GATACAGTGATGCATTTTGATGG + Intergenic
1188825062 X:34821373-34821395 AATGAATTAATGCATCATGAAGG - Intergenic
1189738975 X:44099354-44099376 GATCAAGTGATGGATCTTGAGGG - Intergenic
1191167216 X:57403514-57403536 TTTGTAGGAATGCATCTTGATGG - Intronic
1192940101 X:75902867-75902889 TTTGTAGGAATGCATCTTGATGG - Intergenic
1193172097 X:78348328-78348350 TTTGTAGGAATGCATCTTGATGG - Intergenic