ID: 990607409

View in Genome Browser
Species Human (GRCh38)
Location 5:57424104-57424126
Sequence TCATACCAGTGTGAGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990607402_990607409 23 Left 990607402 5:57424058-57424080 CCAGAGCTCCCTCAAGATGCATT 0: 1
1: 0
2: 0
3: 7
4: 121
Right 990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 134
990607408_990607409 -7 Left 990607408 5:57424088-57424110 CCACAAAGGGGAGAGATCATACC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 134
990607403_990607409 15 Left 990607403 5:57424066-57424088 CCCTCAAGATGCATTACTGCATC 0: 1
1: 0
2: 1
3: 13
4: 138
Right 990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 134
990607404_990607409 14 Left 990607404 5:57424067-57424089 CCTCAAGATGCATTACTGCATCC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990607409 Original CRISPR TCATACCAGTGTGAGATCTG TGG Intergenic
900404538 1:2486642-2486664 CCACACCAGTGCGAGACCTGTGG - Intronic
900736852 1:4304554-4304576 TCACACAAGTGTGGGATTTGGGG - Intergenic
902361197 1:15943489-15943511 CCATGCCAGTGTGTGATGTGCGG - Exonic
906048480 1:42851457-42851479 CCATACCGCTGTGACATCTGTGG + Exonic
906590414 1:47019791-47019813 TCATACCTGTATGAAAACTGAGG - Intergenic
908085723 1:60631695-60631717 CCAGTCCAGTGTGAGATCTTGGG + Intergenic
909153438 1:72038895-72038917 TCATATCATTGTTAGATGTGAGG - Intronic
910190222 1:84587364-84587386 TCCTCCCAGTGTGTGAACTGTGG - Intergenic
910485171 1:87705276-87705298 AAATACCAAGGTGAGATCTGTGG + Intergenic
910847184 1:91614925-91614947 TCTTTCCTGTGTGAAATCTGTGG - Intergenic
913406903 1:118504357-118504379 TCATACGAGTGTGGGAGATGGGG + Intergenic
915039025 1:152952236-152952258 TCCTACCAGGGTAAGATGTGGGG + Intergenic
916862115 1:168817189-168817211 TCATACAAGGGTGAGATGTTAGG + Intergenic
918177091 1:182056398-182056420 CCCTACCAGTGTGAGGACTGCGG - Exonic
920546481 1:206822716-206822738 TCCTACTACTGTGAGGTCTGTGG + Intronic
922248490 1:223824332-223824354 TCATACCAGTGTTAAACCTGTGG - Intronic
923423901 1:233848669-233848691 TCATACCCGTGTGCTAACTGAGG + Intergenic
924293922 1:242566573-242566595 ACATGCCAGTGGGAGTTCTGGGG - Intergenic
924301130 1:242638788-242638810 TCATGACAGTGTGACTTCTGGGG - Intergenic
1065493970 10:26310363-26310385 TCAGATCAGAGTGAGTTCTGGGG + Intergenic
1065553344 10:26890585-26890607 TCACACTAGTGTGAGGTCTCAGG + Intergenic
1067787458 10:49260884-49260906 CCATACCATGGAGAGATCTGGGG - Intergenic
1073303477 10:102485140-102485162 TCACACCAGAGTGAGGTCTACGG - Intronic
1074160799 10:110834921-110834943 TCATAGCAGTGAGTGTTCTGGGG + Intronic
1074880276 10:117651367-117651389 TCATACCAGTGTGATGACAGAGG + Intergenic
1075187239 10:120274053-120274075 ACAAACCAGTGTGAGGTCTTCGG + Intergenic
1077257994 11:1597715-1597737 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077261091 11:1621405-1621427 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1080860843 11:36149018-36149040 TCATCCCAGTGTGCGACATGGGG - Intronic
1084798850 11:71527778-71527800 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084801841 11:71549147-71549169 TGCTACCAGTGCAAGATCTGAGG + Exonic
1084803992 11:71566176-71566198 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084806425 11:71582365-71582387 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1084831609 11:71774112-71774134 TCATGCCACTGTGAGATAGGAGG + Intergenic
1084984840 11:72859803-72859825 TCAGACCTGTGTGAGTTCTGAGG - Intronic
1086397218 11:86429037-86429059 TCATACCATTGTGAAACCTCTGG + Intergenic
1088918869 11:114247206-114247228 CCCTACGAGTGTGAGTTCTGTGG + Exonic
1090338705 11:125995522-125995544 TGAAACCAGAGTGACATCTGCGG - Intronic
1091782501 12:3222818-3222840 TCATCCCAGGGTGGGACCTGGGG - Intronic
1092183739 12:6463459-6463481 TGTTAGCAGTGTGAGATCTTTGG - Intronic
1099521263 12:83666504-83666526 TGATACCAGTAAGGGATCTGAGG - Intergenic
1100584058 12:95963053-95963075 TCTAACCAATATGAGATCTGAGG + Intronic
1108066352 13:46581583-46581605 TCATCCCCGTGTTAGATGTGAGG + Intronic
1108270783 13:48757439-48757461 TCATTCAAGTGGGAGACCTGGGG + Intergenic
1108868666 13:54954104-54954126 TTTTTCCAGTGTGAGATCTTAGG - Intergenic
1110220176 13:73063867-73063889 ACATACCAGTGTGAGTCCTCAGG - Exonic
1112719251 13:102224333-102224355 TCATTTCAGTATCAGATCTGTGG + Intronic
1114455372 14:22850253-22850275 TCATGGCAGTGTGTGTTCTGGGG + Intergenic
1122800627 14:104227708-104227730 ACAAACCAGTGAGAGAGCTGAGG - Intergenic
1125591311 15:40856187-40856209 GGATGCCAGTGTGAGGTCTGGGG + Intronic
1126696711 15:51332359-51332381 ACACACCAATGTGAGACCTGTGG + Intronic
1130089961 15:80812484-80812506 TTATACAGGTGAGAGATCTGAGG - Intronic
1134804729 16:17114538-17114560 TCATGGCAGTGTGAGAGCAGAGG + Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1138974580 16:62188419-62188441 TCATGCCAGTGTGTAATATGTGG + Intergenic
1139148195 16:64347621-64347643 TCATGGCAAGGTGAGATCTGTGG + Intergenic
1141026548 16:80554191-80554213 ACATAGCAGTGTGAAATCTCTGG + Intergenic
1145113308 17:20185038-20185060 TCGAACCAGTGTGAATTCTGTGG - Intronic
1147651844 17:42067355-42067377 CCACACCAGGGTGAGATCTATGG - Intergenic
1149062752 17:52442615-52442637 TCATATAAGTGAGTGATCTGGGG + Intergenic
1149867053 17:60156902-60156924 TCAGACCAGTCTGGGATGTGGGG + Intronic
1150864565 17:68836208-68836230 TCATGACACTGTGAGATCAGAGG - Intergenic
1154253957 18:12767031-12767053 GCAAACCTGTGGGAGATCTGAGG + Intergenic
1156877373 18:42031255-42031277 GTATAACAGTGTTAGATCTGTGG + Intronic
1159165900 18:64699549-64699571 TCATACCTCTGTGAAATTTGGGG + Intergenic
1160516979 18:79484069-79484091 TCATTCCAGTGTGACCTCGGCGG + Intronic
1165410613 19:35658588-35658610 TCATCCCAGTCTGTGACCTGTGG - Exonic
1167896087 19:52582839-52582861 TCTCACCAGTGTGACATCTATGG - Exonic
1168460656 19:56554183-56554205 TCTTGCCAGTGTGACATCTCTGG - Exonic
924984926 2:262503-262525 TCAGACCAGTGTGGCATGTGTGG - Intronic
925871057 2:8271011-8271033 TCATACAAGTGAGGGAGCTGGGG - Intergenic
933160937 2:79024326-79024348 TCAAAACAGTTTGAGATCTCTGG - Intergenic
934855721 2:97728353-97728375 TCATACCACTGTGCCAGCTGTGG - Intronic
936997822 2:118433879-118433901 TCATATCAGTGTGATGGCTGTGG + Intergenic
937800256 2:126074140-126074162 ATAAACCAGTGTGACATCTGTGG - Intergenic
939911532 2:147989345-147989367 TCAGAACAGTCTGAGCTCTGAGG - Intronic
941225463 2:162841510-162841532 TTACACAAGTGTGAGCTCTGTGG + Intergenic
943575569 2:189627146-189627168 GCATACCAGTGGGAGAGATGAGG + Intergenic
943989079 2:194662676-194662698 TCATATCACTCTGATATCTGAGG - Intergenic
945639546 2:212406375-212406397 TCATACTAGTTCTAGATCTGTGG - Intronic
948358281 2:237398193-237398215 TCATTCCACTGTGAGATTGGAGG - Intronic
948463702 2:238142364-238142386 TCCTGGCAGTGGGAGATCTGGGG + Intronic
1172294505 20:33799027-33799049 TCCTACAAGTGTGTGATCTTAGG + Intergenic
1172858817 20:38031078-38031100 TCAAACCAGGGTGGTATCTGTGG - Intronic
1173631968 20:44523140-44523162 TCATACCAGTGTGGCATATTTGG + Intergenic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1177769106 21:25495061-25495083 TCATGCCAGTGAGAAAACTGAGG - Intergenic
1179437080 21:41369471-41369493 TCATCACAGGGTGACATCTGGGG + Intronic
1180666548 22:17517408-17517430 TTATAGCAGTGTGAGAACGGAGG + Intronic
949635093 3:5974018-5974040 TCTTTCCAGTCTGAGGTCTGGGG + Intergenic
950625797 3:14245968-14245990 TCATTCCAGGGTGTGAGCTGGGG + Intergenic
957380529 3:79422727-79422749 TCATAACAGTTTGAGAACTTAGG - Intronic
959887264 3:111517105-111517127 TCAGACCACTGTGAGCTATGAGG + Intronic
960443031 3:117712428-117712450 TCATGTCAGTGTGAGAGCTTTGG - Intergenic
961104154 3:124227098-124227120 CCAGCCCAGTGTGAGATTTGTGG - Intronic
963086916 3:141445497-141445519 CCATACCAGTGCAAGACCTGCGG + Exonic
963094191 3:141517980-141518002 TCAGACTAGAGTGTGATCTGTGG + Intronic
964188849 3:153979466-153979488 TCATACTAGCATCAGATCTGAGG + Intergenic
965319480 3:167233918-167233940 CCATAACAGTTTGAGATCTGTGG - Intergenic
966822116 3:183933329-183933351 ACATACCAGAGTGACAGCTGGGG + Intronic
967202000 3:187079890-187079912 TCATACTAATGTGAGATTAGTGG + Intergenic
969196884 4:5570080-5570102 TAAAACCAATGTGAGATCAGAGG - Intronic
969218532 4:5743592-5743614 TCCTACCACTGTGAGATCTGGGG + Intronic
974486136 4:62508587-62508609 TCATTTCAGACTGAGATCTGAGG - Intergenic
976461418 4:85316671-85316693 GCCTACCATTGTGAGAGCTGTGG - Intergenic
976530771 4:86149797-86149819 TCTTACCTGTGTGGGATCTCAGG - Intronic
976704392 4:88006688-88006710 TCATATCAGGGTGATATCTGTGG + Intergenic
977847158 4:101779810-101779832 TTGGACCAGTGTGATATCTGTGG + Intronic
978638359 4:110838815-110838837 TTTTACCAGTGTGGTATCTGTGG - Intergenic
979154072 4:117360153-117360175 TCTTATCTGTGTGATATCTGTGG - Intergenic
981781686 4:148438054-148438076 TAATACAAGTGTGAAAACTGAGG + Intronic
982390803 4:154862197-154862219 ACATTTCAGTGTGAAATCTGGGG + Intergenic
988637891 5:33006878-33006900 TCTTACCATTGTGAGATCTTAGG - Intergenic
989001454 5:36764832-36764854 TGATACCAGTGTGGGAACTCTGG - Intergenic
990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG + Intergenic
990862319 5:60340427-60340449 TTATACCAGGGTAACATCTGAGG - Intronic
993687443 5:90956858-90956880 GCATAACTGTGTGACATCTGTGG + Intronic
996758754 5:126965287-126965309 TCAGACCAGTGTGAGAACCTTGG - Intronic
999850963 5:155538297-155538319 ACATATCAGTGTTAGCTCTGGGG + Intergenic
1010044882 6:71430008-71430030 TCATCCCAGTGTGAAACTTGTGG + Intergenic
1012412149 6:98970743-98970765 TAATGTCAGTGTGAAATCTGTGG + Intergenic
1016715561 6:147223897-147223919 TCATAACATCTTGAGATCTGTGG + Intronic
1026106363 7:67424073-67424095 TCCTGCCAGGGTGGGATCTGGGG - Intergenic
1029294831 7:99531875-99531897 CCTTATCAGTGTGATATCTGTGG + Exonic
1033998561 7:147384496-147384518 TCAAACCAGGGTGACTTCTGTGG - Intronic
1034026275 7:147708020-147708042 TCATACCACTGGGAGGTCTGAGG - Intronic
1035030280 7:155852424-155852446 TCATAGCAGTGCTAGATTTGAGG - Intergenic
1036378121 8:8218270-8218292 TCATGCCACTGTGAGATAGGAGG + Intergenic
1039244917 8:35598057-35598079 ACAAAGCAGTGTGAGAACTGGGG - Intronic
1043208249 8:77475372-77475394 TTTTACCAATGTGAGAACTGGGG - Intergenic
1046823560 8:118662095-118662117 GGATATCAGTGTGAGATATGTGG + Intergenic
1048380605 8:133861900-133861922 TGATACCAGTTTGAGTTCTCTGG + Intergenic
1050254251 9:3777561-3777583 TCATATCTGTGTTAGATCTTGGG + Intergenic
1051999193 9:23256002-23256024 TTTTACCAGTGGGAGATATGGGG - Intergenic
1055391150 9:75822973-75822995 TCATTCTTGTGTTAGATCTGTGG + Intergenic
1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG + Exonic
1062059771 9:134488911-134488933 TCATTCCAGTGTGAGATGAGGGG + Intergenic
1186143738 X:6603853-6603875 TCATTGCAGTGTGAGAGCAGAGG + Intergenic
1194106172 X:89769613-89769635 TTATAGCAGTGTGAGAACAGTGG + Intergenic
1194520155 X:94908981-94909003 TCATACCATTCTGAGAGCTCTGG - Intergenic
1196896528 X:120342032-120342054 GCATAAGAATGTGAGATCTGTGG - Intergenic
1200458127 Y:3417472-3417494 TTATAGCAGTGTGAGAACAGTGG + Intergenic