ID: 990610674

View in Genome Browser
Species Human (GRCh38)
Location 5:57453899-57453921
Sequence ACCCTCTGCCAGCCAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990610674_990610685 29 Left 990610674 5:57453899-57453921 CCAGACCCTGGCTGGCAGAGGGT No data
Right 990610685 5:57453951-57453973 TAAAATCACATCACGATGTGTGG No data
990610674_990610680 -2 Left 990610674 5:57453899-57453921 CCAGACCCTGGCTGGCAGAGGGT No data
Right 990610680 5:57453920-57453942 GTGTGGCGGCGGTTGCTGTGAGG No data
990610674_990610682 2 Left 990610674 5:57453899-57453921 CCAGACCCTGGCTGGCAGAGGGT No data
Right 990610682 5:57453924-57453946 GGCGGCGGTTGCTGTGAGGGTGG No data
990610674_990610684 6 Left 990610674 5:57453899-57453921 CCAGACCCTGGCTGGCAGAGGGT No data
Right 990610684 5:57453928-57453950 GCGGTTGCTGTGAGGGTGGGTGG No data
990610674_990610681 -1 Left 990610674 5:57453899-57453921 CCAGACCCTGGCTGGCAGAGGGT No data
Right 990610681 5:57453921-57453943 TGTGGCGGCGGTTGCTGTGAGGG No data
990610674_990610683 3 Left 990610674 5:57453899-57453921 CCAGACCCTGGCTGGCAGAGGGT No data
Right 990610683 5:57453925-57453947 GCGGCGGTTGCTGTGAGGGTGGG No data
990610674_990610686 30 Left 990610674 5:57453899-57453921 CCAGACCCTGGCTGGCAGAGGGT No data
Right 990610686 5:57453952-57453974 AAAATCACATCACGATGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990610674 Original CRISPR ACCCTCTGCCAGCCAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr