ID: 990615914

View in Genome Browser
Species Human (GRCh38)
Location 5:57508254-57508276
Sequence GAGCCGTCACCCTAGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990615914_990615925 30 Left 990615914 5:57508254-57508276 CCCCCCATCTAGGGTGACGGCTC No data
Right 990615925 5:57508307-57508329 AACTGAAGAATCTGTGAGTCAGG No data
990615914_990615922 -7 Left 990615914 5:57508254-57508276 CCCCCCATCTAGGGTGACGGCTC No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990615914 Original CRISPR GAGCCGTCACCCTAGATGGG GGG (reversed) Intergenic
No off target data available for this crispr