ID: 990615922

View in Genome Browser
Species Human (GRCh38)
Location 5:57508270-57508292
Sequence ACGGCTCTGGGTGGTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990615911_990615922 0 Left 990615911 5:57508247-57508269 CCCTCTGCCCCCCATCTAGGGTG No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data
990615914_990615922 -7 Left 990615914 5:57508254-57508276 CCCCCCATCTAGGGTGACGGCTC No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data
990615910_990615922 1 Left 990615910 5:57508246-57508268 CCCCTCTGCCCCCCATCTAGGGT No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data
990615917_990615922 -10 Left 990615917 5:57508257-57508279 CCCATCTAGGGTGACGGCTCTGG No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data
990615916_990615922 -9 Left 990615916 5:57508256-57508278 CCCCATCTAGGGTGACGGCTCTG No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data
990615912_990615922 -1 Left 990615912 5:57508248-57508270 CCTCTGCCCCCCATCTAGGGTGA No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data
990615907_990615922 9 Left 990615907 5:57508238-57508260 CCTCTGAGCCCCTCTGCCCCCCA No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data
990615915_990615922 -8 Left 990615915 5:57508255-57508277 CCCCCATCTAGGGTGACGGCTCT No data
Right 990615922 5:57508270-57508292 ACGGCTCTGGGTGGTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990615922 Original CRISPR ACGGCTCTGGGTGGTGCTGA TGG Intergenic
No off target data available for this crispr