ID: 990615925

View in Genome Browser
Species Human (GRCh38)
Location 5:57508307-57508329
Sequence AACTGAAGAATCTGTGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990615914_990615925 30 Left 990615914 5:57508254-57508276 CCCCCCATCTAGGGTGACGGCTC No data
Right 990615925 5:57508307-57508329 AACTGAAGAATCTGTGAGTCAGG No data
990615919_990615925 26 Left 990615919 5:57508258-57508280 CCATCTAGGGTGACGGCTCTGGG No data
Right 990615925 5:57508307-57508329 AACTGAAGAATCTGTGAGTCAGG No data
990615915_990615925 29 Left 990615915 5:57508255-57508277 CCCCCATCTAGGGTGACGGCTCT No data
Right 990615925 5:57508307-57508329 AACTGAAGAATCTGTGAGTCAGG No data
990615916_990615925 28 Left 990615916 5:57508256-57508278 CCCCATCTAGGGTGACGGCTCTG No data
Right 990615925 5:57508307-57508329 AACTGAAGAATCTGTGAGTCAGG No data
990615917_990615925 27 Left 990615917 5:57508257-57508279 CCCATCTAGGGTGACGGCTCTGG No data
Right 990615925 5:57508307-57508329 AACTGAAGAATCTGTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990615925 Original CRISPR AACTGAAGAATCTGTGAGTC AGG Intergenic
No off target data available for this crispr