ID: 990617974

View in Genome Browser
Species Human (GRCh38)
Location 5:57526869-57526891
Sequence GCCATGAAATCCACCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990617974_990617978 23 Left 990617974 5:57526869-57526891 CCTGAAAAGGTGGATTTCATGGC No data
Right 990617978 5:57526915-57526937 CTCTTTTGTCTGTTTATACTGGG No data
990617974_990617977 22 Left 990617974 5:57526869-57526891 CCTGAAAAGGTGGATTTCATGGC No data
Right 990617977 5:57526914-57526936 CCTCTTTTGTCTGTTTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990617974 Original CRISPR GCCATGAAATCCACCTTTTC AGG (reversed) Intergenic
No off target data available for this crispr