ID: 990618873

View in Genome Browser
Species Human (GRCh38)
Location 5:57538563-57538585
Sequence GCCTGCAGAGCTGCAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990618873_990618876 1 Left 990618873 5:57538563-57538585 CCAGTTGCTGCAGCTCTGCAGGC No data
Right 990618876 5:57538587-57538609 TTCCAACCTTCTCTCCACTGGGG No data
990618873_990618880 16 Left 990618873 5:57538563-57538585 CCAGTTGCTGCAGCTCTGCAGGC No data
Right 990618880 5:57538602-57538624 CACTGGGGCTCTCCACGCAGTGG No data
990618873_990618875 0 Left 990618873 5:57538563-57538585 CCAGTTGCTGCAGCTCTGCAGGC No data
Right 990618875 5:57538586-57538608 TTTCCAACCTTCTCTCCACTGGG No data
990618873_990618874 -1 Left 990618873 5:57538563-57538585 CCAGTTGCTGCAGCTCTGCAGGC No data
Right 990618874 5:57538585-57538607 CTTTCCAACCTTCTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990618873 Original CRISPR GCCTGCAGAGCTGCAGCAAC TGG (reversed) Intergenic
No off target data available for this crispr