ID: 990620509

View in Genome Browser
Species Human (GRCh38)
Location 5:57554119-57554141
Sequence AACCTTGAGATTCTACTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990620503_990620509 24 Left 990620503 5:57554072-57554094 CCTTGTTACGGCGGCCCTAGCAA No data
Right 990620509 5:57554119-57554141 AACCTTGAGATTCTACTTACAGG No data
990620508_990620509 -8 Left 990620508 5:57554104-57554126 CCAGGAAAGGAGTTAAACCTTGA No data
Right 990620509 5:57554119-57554141 AACCTTGAGATTCTACTTACAGG No data
990620504_990620509 10 Left 990620504 5:57554086-57554108 CCCTAGCAAACTAATACACCAGG No data
Right 990620509 5:57554119-57554141 AACCTTGAGATTCTACTTACAGG No data
990620506_990620509 9 Left 990620506 5:57554087-57554109 CCTAGCAAACTAATACACCAGGA No data
Right 990620509 5:57554119-57554141 AACCTTGAGATTCTACTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990620509 Original CRISPR AACCTTGAGATTCTACTTAC AGG Intergenic
No off target data available for this crispr