ID: 990620549

View in Genome Browser
Species Human (GRCh38)
Location 5:57554596-57554618
Sequence CCCTGGCAGAGTAACATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990620549_990620554 -7 Left 990620549 5:57554596-57554618 CCATTAATGTTACTCTGCCAGGG No data
Right 990620554 5:57554612-57554634 GCCAGGGGATCTAAAGGTGTGGG No data
990620549_990620556 -2 Left 990620549 5:57554596-57554618 CCATTAATGTTACTCTGCCAGGG No data
Right 990620556 5:57554617-57554639 GGGATCTAAAGGTGTGGGAGAGG No data
990620549_990620553 -8 Left 990620549 5:57554596-57554618 CCATTAATGTTACTCTGCCAGGG No data
Right 990620553 5:57554611-57554633 TGCCAGGGGATCTAAAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990620549 Original CRISPR CCCTGGCAGAGTAACATTAA TGG (reversed) Intergenic
No off target data available for this crispr