ID: 990621784

View in Genome Browser
Species Human (GRCh38)
Location 5:57567802-57567824
Sequence GCCTCCTAGAGAAGAAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990621784_990621787 26 Left 990621784 5:57567802-57567824 CCCTGCTTTCTTCTCTAGGAGGC No data
Right 990621787 5:57567851-57567873 ATCAAGAACACCCTTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990621784 Original CRISPR GCCTCCTAGAGAAGAAAGCA GGG (reversed) Intergenic
No off target data available for this crispr