ID: 990624452

View in Genome Browser
Species Human (GRCh38)
Location 5:57595856-57595878
Sequence CATTATGCACAGCAGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990624451_990624452 4 Left 990624451 5:57595829-57595851 CCTGCATATTATAAATCTTCAAG No data
Right 990624452 5:57595856-57595878 CATTATGCACAGCAGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990624452 Original CRISPR CATTATGCACAGCAGCTGCT TGG Intergenic
No off target data available for this crispr