ID: 990627396

View in Genome Browser
Species Human (GRCh38)
Location 5:57630118-57630140
Sequence GAGAATATACAAATGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990627390_990627396 21 Left 990627390 5:57630074-57630096 CCTTGCTGCTGTGAGGAGTCCAA No data
Right 990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG No data
990627394_990627396 2 Left 990627394 5:57630093-57630115 CCAAGTAGGTAGAAAGGGAGAAC No data
Right 990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990627396 Original CRISPR GAGAATATACAAATGGATAA TGG Intergenic
No off target data available for this crispr