ID: 990629846

View in Genome Browser
Species Human (GRCh38)
Location 5:57656274-57656296
Sequence CTAATTCACTAATTCTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990629838_990629846 20 Left 990629838 5:57656231-57656253 CCTCAACATTCCCTTAAGCCAAA 0: 267
1: 556
2: 628
3: 468
4: 439
Right 990629846 5:57656274-57656296 CTAATTCACTAATTCTCTAAAGG No data
990629841_990629846 2 Left 990629841 5:57656249-57656271 CCAAAGCCTAATTCAGAGCAAGG 0: 24
1: 334
2: 705
3: 658
4: 586
Right 990629846 5:57656274-57656296 CTAATTCACTAATTCTCTAAAGG No data
990629840_990629846 9 Left 990629840 5:57656242-57656264 CCTTAAGCCAAAGCCTAATTCAG 0: 48
1: 395
2: 660
3: 607
4: 524
Right 990629846 5:57656274-57656296 CTAATTCACTAATTCTCTAAAGG No data
990629839_990629846 10 Left 990629839 5:57656241-57656263 CCCTTAAGCCAAAGCCTAATTCA 0: 45
1: 380
2: 638
3: 587
4: 457
Right 990629846 5:57656274-57656296 CTAATTCACTAATTCTCTAAAGG No data
990629843_990629846 -4 Left 990629843 5:57656255-57656277 CCTAATTCAGAGCAAGGCCCTAA 0: 21
1: 269
2: 587
3: 674
4: 621
Right 990629846 5:57656274-57656296 CTAATTCACTAATTCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990629846 Original CRISPR CTAATTCACTAATTCTCTAA AGG Intergenic
No off target data available for this crispr