ID: 990631518

View in Genome Browser
Species Human (GRCh38)
Location 5:57675530-57675552
Sequence CTGAAATTGCTAGAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990631518_990631526 5 Left 990631518 5:57675530-57675552 CCCTCCACTTCTAGCAATTTCAG No data
Right 990631526 5:57675558-57675580 GGGGTGGAGAACCCTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990631518 Original CRISPR CTGAAATTGCTAGAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr