ID: 990631579

View in Genome Browser
Species Human (GRCh38)
Location 5:57676118-57676140
Sequence CAAAATAAATAGAGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990631572_990631579 5 Left 990631572 5:57676090-57676112 CCCATCATATCTAAATCGGCAAA No data
Right 990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG No data
990631570_990631579 10 Left 990631570 5:57676085-57676107 CCAAACCCATCATATCTAAATCG No data
Right 990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG No data
990631573_990631579 4 Left 990631573 5:57676091-57676113 CCATCATATCTAAATCGGCAAAA No data
Right 990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990631579 Original CRISPR CAAAATAAATAGAGGGATGG GGG Intergenic
No off target data available for this crispr