ID: 990637079

View in Genome Browser
Species Human (GRCh38)
Location 5:57740773-57740795
Sequence AGGAGGACATTGATACTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990637073_990637079 22 Left 990637073 5:57740728-57740750 CCTTTAAGTTAGGCATTATTATC No data
Right 990637079 5:57740773-57740795 AGGAGGACATTGATACTTACAGG No data
990637076_990637079 0 Left 990637076 5:57740750-57740772 CCTGGATTTACGAAGGTTTGCAA No data
Right 990637079 5:57740773-57740795 AGGAGGACATTGATACTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990637079 Original CRISPR AGGAGGACATTGATACTTAC AGG Intergenic
No off target data available for this crispr