ID: 990637445

View in Genome Browser
Species Human (GRCh38)
Location 5:57745005-57745027
Sequence GTGTGTGTATGTAAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990637445_990637447 21 Left 990637445 5:57745005-57745027 CCTCCTTTCTTACATACACACAC No data
Right 990637447 5:57745049-57745071 AACACACACTTATTTCAATGAGG No data
990637445_990637448 22 Left 990637445 5:57745005-57745027 CCTCCTTTCTTACATACACACAC No data
Right 990637448 5:57745050-57745072 ACACACACTTATTTCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990637445 Original CRISPR GTGTGTGTATGTAAGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr