ID: 990647716

View in Genome Browser
Species Human (GRCh38)
Location 5:57863363-57863385
Sequence TTCACAGGAAACTCTCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990647714_990647716 12 Left 990647714 5:57863328-57863350 CCATAAGCTATGTTATTTGATAA No data
Right 990647716 5:57863363-57863385 TTCACAGGAAACTCTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990647716 Original CRISPR TTCACAGGAAACTCTCATAT TGG Intergenic
No off target data available for this crispr