ID: 990650206

View in Genome Browser
Species Human (GRCh38)
Location 5:57889704-57889726
Sequence AGAATGCCCAAAGGTTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990650198_990650206 28 Left 990650198 5:57889653-57889675 CCACAGGCATGCCCTGACTGACC No data
Right 990650206 5:57889704-57889726 AGAATGCCCAAAGGTTGGTGTGG No data
990650202_990650206 16 Left 990650202 5:57889665-57889687 CCTGACTGACCACAAATGGGCGA No data
Right 990650206 5:57889704-57889726 AGAATGCCCAAAGGTTGGTGTGG No data
990650203_990650206 7 Left 990650203 5:57889674-57889696 CCACAAATGGGCGAGAGCACATG No data
Right 990650206 5:57889704-57889726 AGAATGCCCAAAGGTTGGTGTGG No data
990650201_990650206 17 Left 990650201 5:57889664-57889686 CCCTGACTGACCACAAATGGGCG No data
Right 990650206 5:57889704-57889726 AGAATGCCCAAAGGTTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990650206 Original CRISPR AGAATGCCCAAAGGTTGGTG TGG Intergenic