ID: 990669519

View in Genome Browser
Species Human (GRCh38)
Location 5:58112505-58112527
Sequence ACATCTATTCTATATAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990669519_990669526 30 Left 990669519 5:58112505-58112527 CCTGGCCTATATAGAATAGATGT No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990669519 Original CRISPR ACATCTATTCTATATAGGCC AGG (reversed) Intergenic
No off target data available for this crispr