ID: 990669520

View in Genome Browser
Species Human (GRCh38)
Location 5:58112510-58112532
Sequence ACATGACATCTATTCTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990669520_990669526 25 Left 990669520 5:58112510-58112532 CCTATATAGAATAGATGTCATGT No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990669520 Original CRISPR ACATGACATCTATTCTATAT AGG (reversed) Intergenic
No off target data available for this crispr