ID: 990669522

View in Genome Browser
Species Human (GRCh38)
Location 5:58112539-58112561
Sequence TAGTTGTCTCAGCTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990669522_990669528 13 Left 990669522 5:58112539-58112561 CCTTCCCCAAGCTGAGACAACTA No data
Right 990669528 5:58112575-58112597 ACATGGCCAAATGTCCCCTCAGG No data
990669522_990669529 14 Left 990669522 5:58112539-58112561 CCTTCCCCAAGCTGAGACAACTA No data
Right 990669529 5:58112576-58112598 CATGGCCAAATGTCCCCTCAGGG No data
990669522_990669526 -4 Left 990669522 5:58112539-58112561 CCTTCCCCAAGCTGAGACAACTA No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990669522 Original CRISPR TAGTTGTCTCAGCTTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr