ID: 990669526

View in Genome Browser
Species Human (GRCh38)
Location 5:58112558-58112580
Sequence ACTAAAAATGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990669519_990669526 30 Left 990669519 5:58112505-58112527 CCTGGCCTATATAGAATAGATGT No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data
990669525_990669526 -10 Left 990669525 5:58112545-58112567 CCAAGCTGAGACAACTAAAAATG No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data
990669520_990669526 25 Left 990669520 5:58112510-58112532 CCTATATAGAATAGATGTCATGT No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data
990669524_990669526 -9 Left 990669524 5:58112544-58112566 CCCAAGCTGAGACAACTAAAAAT No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data
990669522_990669526 -4 Left 990669522 5:58112539-58112561 CCTTCCCCAAGCTGAGACAACTA No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data
990669523_990669526 -8 Left 990669523 5:58112543-58112565 CCCCAAGCTGAGACAACTAAAAA No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data
990669521_990669526 -1 Left 990669521 5:58112536-58112558 CCTCCTTCCCCAAGCTGAGACAA No data
Right 990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990669526 Original CRISPR ACTAAAAATGTCTCCAGACA TGG Intergenic
No off target data available for this crispr