ID: 990675033

View in Genome Browser
Species Human (GRCh38)
Location 5:58174561-58174583
Sequence AGATAACACAAAGAAATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990675033_990675037 11 Left 990675033 5:58174561-58174583 CCTTCTATTTCTTTGTGTTATCT No data
Right 990675037 5:58174595-58174617 CTTGTCTAGGACATCATCTTTGG No data
990675033_990675034 -2 Left 990675033 5:58174561-58174583 CCTTCTATTTCTTTGTGTTATCT No data
Right 990675034 5:58174582-58174604 CTCTACCACTATCCTTGTCTAGG No data
990675033_990675038 28 Left 990675033 5:58174561-58174583 CCTTCTATTTCTTTGTGTTATCT No data
Right 990675038 5:58174612-58174634 CTTTGGACACCTGAAGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990675033 Original CRISPR AGATAACACAAAGAAATAGA AGG (reversed) Intergenic
No off target data available for this crispr