ID: 990675037

View in Genome Browser
Species Human (GRCh38)
Location 5:58174595-58174617
Sequence CTTGTCTAGGACATCATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990675033_990675037 11 Left 990675033 5:58174561-58174583 CCTTCTATTTCTTTGTGTTATCT No data
Right 990675037 5:58174595-58174617 CTTGTCTAGGACATCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990675037 Original CRISPR CTTGTCTAGGACATCATCTT TGG Intergenic
No off target data available for this crispr