ID: 990676764

View in Genome Browser
Species Human (GRCh38)
Location 5:58195433-58195455
Sequence TCCCCACAGCAGAGGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990676764_990676771 25 Left 990676764 5:58195433-58195455 CCAGAGAACCTCTGCTGTGGGGA No data
Right 990676771 5:58195481-58195503 GCTGGGCTAGGGTGAAGCAATGG No data
990676764_990676766 7 Left 990676764 5:58195433-58195455 CCAGAGAACCTCTGCTGTGGGGA No data
Right 990676766 5:58195463-58195485 ACCAGCAAAGCTTTTAGTGCTGG No data
990676764_990676770 14 Left 990676764 5:58195433-58195455 CCAGAGAACCTCTGCTGTGGGGA No data
Right 990676770 5:58195470-58195492 AAGCTTTTAGTGCTGGGCTAGGG No data
990676764_990676768 8 Left 990676764 5:58195433-58195455 CCAGAGAACCTCTGCTGTGGGGA No data
Right 990676768 5:58195464-58195486 CCAGCAAAGCTTTTAGTGCTGGG No data
990676764_990676769 13 Left 990676764 5:58195433-58195455 CCAGAGAACCTCTGCTGTGGGGA No data
Right 990676769 5:58195469-58195491 AAAGCTTTTAGTGCTGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990676764 Original CRISPR TCCCCACAGCAGAGGTTCTC TGG (reversed) Intergenic
No off target data available for this crispr