ID: 990679001

View in Genome Browser
Species Human (GRCh38)
Location 5:58220067-58220089
Sequence GGGCATTCAATTACAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990678997_990679001 8 Left 990678997 5:58220036-58220058 CCAGGGCAATCAGGCAGAAGAAG 0: 51
1: 2918
2: 6086
3: 5103
4: 4591
Right 990679001 5:58220067-58220089 GGGCATTCAATTACAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990679001 Original CRISPR GGGCATTCAATTACAAAAAC AGG Intergenic
No off target data available for this crispr