ID: 990679603

View in Genome Browser
Species Human (GRCh38)
Location 5:58226884-58226906
Sequence CATACCATGGAAAAGTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990679600_990679603 -3 Left 990679600 5:58226864-58226886 CCACTGTGGCACTACACATCCAT No data
Right 990679603 5:58226884-58226906 CATACCATGGAAAAGTACTCAGG No data
990679597_990679603 20 Left 990679597 5:58226841-58226863 CCTAAACAGGTTAATGGATAAAC No data
Right 990679603 5:58226884-58226906 CATACCATGGAAAAGTACTCAGG No data
990679596_990679603 21 Left 990679596 5:58226840-58226862 CCCTAAACAGGTTAATGGATAAA No data
Right 990679603 5:58226884-58226906 CATACCATGGAAAAGTACTCAGG No data
990679599_990679603 -2 Left 990679599 5:58226863-58226885 CCCACTGTGGCACTACACATCCA No data
Right 990679603 5:58226884-58226906 CATACCATGGAAAAGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990679603 Original CRISPR CATACCATGGAAAAGTACTC AGG Intergenic
No off target data available for this crispr