ID: 990685833

View in Genome Browser
Species Human (GRCh38)
Location 5:58300084-58300106
Sequence CCTTCTATGTGGAAGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990685833_990685841 12 Left 990685833 5:58300084-58300106 CCAACCCCCTTCCACATAGAAGG No data
Right 990685841 5:58300119-58300141 CAGCAGCACTCTTCCTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990685833 Original CRISPR CCTTCTATGTGGAAGGGGGT TGG (reversed) Intergenic
No off target data available for this crispr