ID: 990696106

View in Genome Browser
Species Human (GRCh38)
Location 5:58419515-58419537
Sequence TTACCTTAGTCTAGGTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990696106_990696112 9 Left 990696106 5:58419515-58419537 CCCAAGAACCTAGACTAAGGTAA No data
Right 990696112 5:58419547-58419569 ATGGAAGAAGCTTGGGCCCCTGG No data
990696106_990696110 1 Left 990696106 5:58419515-58419537 CCCAAGAACCTAGACTAAGGTAA No data
Right 990696110 5:58419539-58419561 GACACAAAATGGAAGAAGCTTGG No data
990696106_990696113 10 Left 990696106 5:58419515-58419537 CCCAAGAACCTAGACTAAGGTAA No data
Right 990696113 5:58419548-58419570 TGGAAGAAGCTTGGGCCCCTGGG No data
990696106_990696111 2 Left 990696106 5:58419515-58419537 CCCAAGAACCTAGACTAAGGTAA No data
Right 990696111 5:58419540-58419562 ACACAAAATGGAAGAAGCTTGGG No data
990696106_990696109 -10 Left 990696106 5:58419515-58419537 CCCAAGAACCTAGACTAAGGTAA No data
Right 990696109 5:58419528-58419550 ACTAAGGTAAAGACACAAAATGG No data
990696106_990696114 23 Left 990696106 5:58419515-58419537 CCCAAGAACCTAGACTAAGGTAA No data
Right 990696114 5:58419561-58419583 GGCCCCTGGGTCATTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990696106 Original CRISPR TTACCTTAGTCTAGGTTCTT GGG (reversed) Intergenic
No off target data available for this crispr