ID: 990700325

View in Genome Browser
Species Human (GRCh38)
Location 5:58467956-58467978
Sequence AGTTGGGTATGGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990700325_990700333 -4 Left 990700325 5:58467956-58467978 CCCTCTTCCTTCCATACCCAACT No data
Right 990700333 5:58467975-58467997 AACTGAGTCTTTGGGACTTCAGG No data
990700325_990700337 29 Left 990700325 5:58467956-58467978 CCCTCTTCCTTCCATACCCAACT No data
Right 990700337 5:58468008-58468030 CCAAACAGATATGTGGAAAAGGG No data
990700325_990700335 28 Left 990700325 5:58467956-58467978 CCCTCTTCCTTCCATACCCAACT No data
Right 990700335 5:58468007-58468029 ACCAAACAGATATGTGGAAAAGG No data
990700325_990700334 22 Left 990700325 5:58467956-58467978 CCCTCTTCCTTCCATACCCAACT No data
Right 990700334 5:58468001-58468023 ACAAAGACCAAACAGATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990700325 Original CRISPR AGTTGGGTATGGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr