ID: 990701434

View in Genome Browser
Species Human (GRCh38)
Location 5:58478993-58479015
Sequence CCACAGGATGTTCCAACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990701429_990701434 13 Left 990701429 5:58478957-58478979 CCTGGCTCAACCCATCAGAGCAT No data
Right 990701434 5:58478993-58479015 CCACAGGATGTTCCAACAGTTGG No data
990701430_990701434 3 Left 990701430 5:58478967-58478989 CCCATCAGAGCATCACACATCTC No data
Right 990701434 5:58478993-58479015 CCACAGGATGTTCCAACAGTTGG No data
990701431_990701434 2 Left 990701431 5:58478968-58478990 CCATCAGAGCATCACACATCTCT No data
Right 990701434 5:58478993-58479015 CCACAGGATGTTCCAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990701434 Original CRISPR CCACAGGATGTTCCAACAGT TGG Intergenic
No off target data available for this crispr